GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

RDH10
retinol dehydrogenase 10

Gene
Official SymbolRDH10
Official Full Nameretinol dehydrogenase 10
CGNC ID11661
also known asretinol dehydrogenase 10|retinol dehydrogenase 10 (all-trans)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
GenomicGenbank
RNANM_001199459
PolypeptideNP_001186388
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2606
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human157506ENSG00000121039MIM:607599
Mouse98711All phenotypic alleles (5):Chemically induced(2) Targeted, knock-out(1) Targeted, other(2) MGI:1924238
Xenopus496504, 446860, 431995944960
Zebrafish562840, 378722ENSDARG00000058730, ENSDARG00000012369ZDB-GENE-070112-2242, ZDB-GENE-030909-7ZFIN:ZDB-GENE-070112-2242, ZFIN:ZDB-GENE-030909-7
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420183
Ensembl Gene
KEGGgga:420183

Entry 1

GEISHA IdRDH10.Reijntjes.2010Data SourcePublication
Complete cDNA Template Probeshow
GGGTGCAGGATCAGAAAAGAAATTGAGCCTTTCCTTCCACCGTTGAAACCAGAATACTGTGTGAAGCAGGCTATGAGAG
CTATCCTTACAGACCAGCCGATGATCTGCACACCTCGCCTCATGTATATGGTCACCTTCATGAAAAGTATTCTGCCCTT
TGAAGCAGTTGTGTGCATGTACCGGTTTTTGGGAGCAGACAAGTGTATGTACCCCTTCATTGCTCAAAGGAAACAGGCT
ACAAACAACAATGAAGCAAAAAATGGAATTTAACACTGGTTTGGATGGACTAACGTTTATAGGTGAATATGATGTTACC
TGAGTGAATCGTGAAGTGCACTTGCATCTAAGAGATGCAAAAAGTCATCATCTTACTGTGGCATTCTCTTGGGTCCTCA
ACCTGTGTACCTGTGT
CitationReijntjes S, Zile MH, Maden M. The expression of Stra6 and Rdh10 in the avian embryo and their contribution to the generation of retinoid signatures. Int J Dev Biol. 2010;54(8-9):1267-75.
Copyright© 2010 UBC Press
CommentsThe cDNA template used to generate the probe was obtained by PCR as described in Reijntjes et al.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 5
Early Mesoderm
Epiblast
band of mesoderm
7-12
stage 7
stage 8
stage 9
stage 10
Heart
Intermediate Mesoderm
Somites
endocardial tube
13-18
stage 14
stage 16
stage 16
stage 16
Eye
Heart
Intermediate Mesoderm
Somites
 
19-23
stage 19
stage 19
stage 20
stage 21
stage 23
stage 23
stage 23
stage 23
Cardiovascular
Eye
Hindgut
Limb Buds
Mesonephros
Neural Plate/Tube
Somites
Tail
coelomic epithelium
intersomitic segments
roof plate

Entry 2

GEISHA IdRDH10.Smith.2018Data SourcePublication
Complete cDNA Template Probeshow
GGGTGCAGGATCAGAAAAGAAATTGAGCCTTTCCTTCCACCGTTGAAACCAGAATACTGTGTGAAGCAGGCTATGAGAG
CTATCCTTACAGACCAGCCGATGATCTGCACACCTCGCCTCATGTATATGGTCACCTTCATGAAAAGTATTCTGCCCTT
TGAAGCAGTTGTGTGCATGTACCGGTTTTTGGGAGCAGACAAGTGTATGTACCCCTTCATTGCTCAAAGGAAACAGGCT
ACAAACAACAATGAAGCAAAAAATGGAATTTAACACTGGTTTGGATGGACTAACATTTATAGGTGAATATGATGTTACC
TGAGTGAATTGTGAAGTGCACTTGCATCTAAGAGATGCAAAAAGTCATCATCTTACTGTGGCATTCTCTTGGGTCCTCA
ACCTGTGT
CitationJonathan N Smith, Heather M Walker, Hannah Thompson, J Martin Collinson, Neil Vargesson, Lynda Erskine. Lens-regulated retinoic acid signalling controls expansion of the developing eye. Development. 2018 Oct 10;145(19):dev167171. DOI: 10.1242/dev.167171.
CopyrightCopyright © 2018. Published by The Company of Biologists Ltd.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Smith et al. 2018.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
stage 23
stage 24
Eye
Retina
 
25-28
stage 26
stage 26
stage 26
stage 26
stage 27
stage 27
stage 28
stage 28
Eye
Retina
 
all
 
 
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2606

Mouse

EmageMGI:1924238
EurexpressMGI:1924238
MGI GXDMGI:1924238

Frog

Xenbase944960

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070112-2242, ZDB-GENE-030909-7
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona