GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF16B
kinesin family member 16B

Gene
Official SymbolKIF16B
Official Full Namekinesin family member 16B
CGNC ID6622
also known asC20orf23, kinesin-like protein KIF16B
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_419330
PolypeptideXP_419330
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.51099
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly43310FBgn0004387
Human55614ENSG00000089177
Mouse16558ENSMUSG00000038844All phenotypic alleles (1):Targeted, other(1) MGI:1098240
Xenopus100489716948786
Zebrafish100334507ENSDARG00000074158ZDB-GENE-070424-241, ZDB-GENE-090313-233ZFIN:ZDB-GENE-070424-241, ZFIN:ZDB-GENE-090313-233
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421260
Ensembl GeneENSGALG00000008725
KEGGgga:421260
GEISHA IdKIF16B.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerAGCCCTTGAACAAGACCGG
Reverse cDNA Template PrimerCATTGTCTGCTGCGTGGTCcDNA Template Length946
Complete cDNA Template Probeshow
AGCCCTTGAACAAGACCGGGAGCGCCTGGACCAGGAAATTCAGCAACTGAAGCAAAAAATATATGAGAGTGATGGTGGT
CAGAAAGGAAATCATGGAATGTTAGAGGAGAAACTGTCCCATAGCAATTCCCCGACAAACCCAACAAAGCCACAGCCAC
CCTCTGCTCCGCTGGTTGATGACAGGATAAATGCCTTTATTGAACAAGAAGTGCAGAGACGGCTCCAAAACATCCACCA
TAAAGCTGAGGATAATGATGGTAGCCTGTTCTGGTCTACAGAAAGTTTAAAGGATAATGAGAGGCTTAATAATGGCACC
ACTCAGCGCAAGCTGAAGTATGAGAAAAGTCAACAGTGGCAGCCACATTGTGATTTTCCATTTATTTCTAAAGATGACA
AATGTGCTTCTGAGTTGTGTGGAGAAAACACAGGAGTAACAGATCATGAAAGACTGAAGGAACATACAGAGATGTTGGA
CTTATTTTTCAGGCCTGAAAGAATCTCCTCCCCCTTTACATCAGAAAAGGCATTTGAGAATGGAAGGAGAAATGCAGAA
CAGGAGAGCTTTGCTAGTCTTTATGACACTGAAAGTAGTTTAACTCACTCTGAAAATATTAATACTTCAAAGAGTAAGA
ATGTTCCTTATCAGAATGTTTTATCTACTTCTTTACAGAGTCATGACTTAAATAATGTGGCTTACTCACTCTGCAAATT
TGAAAATTTCAATCATTTTGACGATAAAATAATTACTTCTCAGGATTGTGACAGCTTAAGAACTGAATGTGATTGTTCC
CGCTTGGAACAGCTGTCTCCTTTAGGATCCTTAATGTGTGCTAATGAGCAGGCTGGTTTTAACAGCATATCGTGCCTTG
CCTTTCCTCAGTCTAACATACATTCTGAAAAAACTGTTAAAGAAAGCAGATCATTTAAGACCACGCAGCAGACAATG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 9
Unlabeled
 
13-18
stage 13
stage 17
Head Mesenchyme
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
 
19
stage 19
Allantois
Foregut
Head Mesenchyme
Pharyngeal Arches and Clefts
Sclerotome
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.51099

Mouse

EmageMGI:1098240
EurexpressMGI:1098240
MGI GXDMGI:1098240

Frog

Xenbase948786

Fruit Fly

BDGPFBgn0004387

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070424-241, ZDB-GENE-090313-233
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona