GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TFAP2E
transcription factor AP-2 epsilon

Gene
Official SymbolTFAP2E
Official Full Nametranscription factor AP-2 epsilon
CGNC ID1707
also known astranscription factor AP-2-epsilon|transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_417778
PolypeptideXP_417778
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.49235
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human339488ENSG00000116819MIM:614428
Mouse332937ENSMUSG00000042477All phenotypic alleles (4):Targeted, other(4) MGI:2679630
Xenopus100170172, 735028876802
Zebrafish393794ENSDARG00000008861ZDB-GENE-040426-1455ZFIN:ZDB-GENE-040426-1455
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene419631
Ensembl Gene
KEGGgga:419631
GEISHA IdChEST104e8Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
TNGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCGGCTCGAGGCGGCTCGAGCCAAAGCAGCAGCAGAGTACCTGTGC
CGACAGCACTCCGACCCCACGGAGCTCCACACCAGGAAGAACATGCTGCTGGCCACCAAGCAAATTTGCAAAGAGTTTG
CAGACTTGATAGCGCAGGACCGCTCACCGCTGGGGAACAGCCGCCCCTCGCTGATCCTGGAGCCGGGAGTGCAGAGCTG
TCTGACTCATTTCAGCCTCATCACCCACGGCTTCGGCGGCCCGGCCATCTGCGCAGCACTCACGGCCTTCCAGAACTAC
CTGGTGGAGTCCCTCAAAGGGCTGGATAAAATGTTCATCAGCAGCACAGGGAACGGGCACACGGCCGGAGACTCCAAAG
CGTCAGAGAAGGAAGGGAAGCATCGGAAGTGAGGTGCAGACCCCATCCCCTGCCTGGGGAGCTCCCACCGCCCGAGGAA
GGGCAGCAGTGCCGGGAGGACGCGGCGCTTTNTGAACTGCTCCATTCGAACTGGGGGGTGAAACTCACAATGCAAGCAA
CAAAAGGAGAGAAACACATTGAGAATTAGGAGGAAGAAAACAACTCTGACCGACGTGGCGAGGAGGAGAAAATGAGCCA
GTTTGATGGCTTCTTAGTTGTGCTTTTTTTTTTTTTTTTTTTTTTTTTACTTTTAAGTCACGGATGCAGGAAGCCAAGT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 13
stage 13
stage 14
stage 16
Ear/Otic Placcode
Eye
Forebrain
Intermediate Mesoderm
Nephric Ducts
Pharyngeal Arches and Clefts
Primitive Streak
 
19-22
stage 22
Ear/Otic Placcode
Eye
Forebrain
Nephric Ducts
Pharyngeal Arches and Clefts
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.49235

Mouse

EmageMGI:2679630
EurexpressMGI:2679630
MGI GXDMGI:2679630

Frog

Xenbase876802

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-1455
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona