GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

AFDN
afadin, adherens junction formation factor

Gene
Official SymbolAFDN
Official Full Nameafadin, adherens junction formation factor
CGNC ID51504
also known asMLLT4, afadin|myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4|myeloid/lymphoid or mixed-lineage leukemia; translocated to, 4
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_419605
PolypeptideXP_419605
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.54416
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly40620FBgn0259212
Human4301ENSG00000130396MIM:159559
Mouse17356ENSMUSG00000068036All phenotypic alleles (5):Targeted, knock-out(2) Targeted, other(3) MGI:1314653
Xenopus100493083, 496308948332
Zebrafish558359ENSDARG00000029472ZDB-GENE-050419-52, ZDB-GENE-130530-932ZFIN:ZDB-GENE-050419-52, ZFIN:ZDB-GENE-130530-932
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421564
Ensembl Gene
KEGGgga:421564
GEISHA IdChEST127p23Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCCAGACATGCGCTTGTTGTCATCCCCTAAATACTCGCTCTATGAGGTGCATGTCAGTGGAGAAGAAAGAAGATTAGAT
GTGGATGAGAAGCCTCTTGTTGTACAATTAAACTGGAACAAAGATGATCGAGAAGGAAGGTTTGTTCTCAAGAATGAAA
ATGATACGCTTCCTCCAAAGAAGGCTCAGAGTAATGGCCCTGAAAAACAAGAAAAAGAAGGAGTAATACAGAATTTCAA
ACGAACTCTCTCAAAGAAAGAAAAGAAAGAGAAGAAGAGGCGTGAAAAAGAGGCATTGCGACAAGCATCAGATAAAGAT
GATCGACTTCTTCATGGGGATGATATTGAGAATTCTCGCCTTGCAGCTGAGGTTTACAAAGATATGCCTGAGACCAGCT
TCACTCGCACAATATCTAATCCTGAGGTGGTTATGAAACGACGGCGGCAGCAAAAACTAGAGAAGAGAATGCAGGAATT
TCGCAGTTCTGATGGCAGACCAGACTCAGGTGGGACGCTGAGAATTTATGCGGACAGTTTAAAACCAAATATACCATAC
AAGACAATCCTGTTGTCAACTACAGATACTGCAGACTTTGCAGTTAGTGAAGCACTGGAGAAATACGGCTTGGAGAAGG
AAAACCCCAAGGATTATTGTATTGCTCGTGTCATTCTGCCTCCTGGTGCTCAGCACTCTGATGATAAAGGTGCTAAAGA
AACTATTCTAGATGATGATGAGTGTCCACTTCAGATATTCAGGGAATGGCCTAGTGATAAAGGAATACTAGTCTTTCAG
TTTGAAAGGCGGCCTCCTGATTATGTCCCAAAGAAATCCAAGAAAAAGCTGATGGAAAGCCTTTAAGGGGAAAGAAAAA
TTGACGGGCTGGCTTCGGCTCTTGCCTTCTTCTGAAAAACTACCAAC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 12
stage 12
Endoderm
Intermediate Mesoderm
Lateral Plate Mesoderm
Notochord
Sinus Venosus
Surface Ectoderm
 
13-18
stage 17
stage 17
stage 18
Amnion
Proepicardium
 
19-23
stage 20
stage 22
stage 23
Allantois
Amnion
Surface Ectoderm
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.54416

Mouse

EmageMGI:1314653
EurexpressMGI:1314653
MGI GXDMGI:1314653

Frog

Xenbase948332

Fruit Fly

BDGPFBgn0259212

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050419-52, ZDB-GENE-130530-932
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona