GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF1C
kinesin family member 1C

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolKIF1C
Official Full Namekinesin family member 1C
CGNC ID1966
also known asKIF1B, kinesin-like protein KIF1B|kinesin family member 1B, Kinesin-like protein KIF1B, Klp
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_417608
PolypeptideXP_417608
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.48506
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human23095ENSG00000054523MIM:118210MIM:605995
Mouse16561ENSMUSG00000063077All phenotypic alleles (3):Targeted, knock-out(1) Targeted, other(2) MGI:108426
Xenopus1003798101013590
Zebrafish369190ENSDARG00000037020ZDB-GENE-030820-1ZFIN:ZDB-GENE-030820-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene419449
Ensembl Gene
KEGGgga:419449
GEISHA IdChEST439i24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCGGCTCGAGGCGGCTCGAGGCGGTTCGAGTATGCCACTCTCAAAGCCAGTGCCAGCTACAAAGCTAAATACTATGAGC
AAACCCAGCCTGGGCCAGAGTGTGAGCAAATACGACCTCCTTGTCTGGTTTGAGATCAGTGAATTGGAGCCAACTGGCG
AGTATATTCCTGCTATTGTGGACCACACTGGATGCCTGCCTTGTCAGGGGACATTCCTGCTTCACCAGGGAATCCAACG
TAGAATCACAGTCACCATTATCCATGAGAAAGGCAATGAACTGCACTGGAAAGATGTACGAGAGCTGGTTGTTGGACGT
ATAAGAAACAAAGCAGAAGTAGATGAAGCTGCTGTGGATGCTATTTTGTCTTTGAATATTATTTCTGCAAAATACCTGA
AGTCATCTCACAGCTCCAATAGGACTTTCTATCGGTTCGAAGCAGTTTGGGATAGCTCTTTGCATAACTCCCTTCTCCT
CAACCGAGTCACCCCATATGGAGAGAAGATATATATGACCCTTTCTGCTTACCTGGAGCTTGACCACTGCATTCAGCCT
GCTGTTATAACAAAGGATGTTTGTATGGTCTTTTATTCACGTGATGCCAAGATCTCTCCACCACGATCACTGCGCAATC
TCTTTGGCAGTGGCTACTCCAAATCTCCAGATTCCAATCGAGTAACTGGGATCTATGAACTGAGTTTATGCAAAATGGC
AGACACAGGGAGTCCCGGAATGCAGAGGAGGAGGAGGAAAGTCCTGGATACATCTGTGGC
CommentsNo specific expression detected stages 11-18.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
Cranial Ganglia
Nasal Placcode/Nerve
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.48506

Mouse

EmageMGI:108426
EurexpressMGI:108426
MGI GXDMGI:108426

Frog

Xenbase1013590

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030820-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona