GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KIF18A
kinesin family member 18A

Gene
Official SymbolKIF18A
Official Full Namekinesin family member 18A
CGNC ID9227
also known askinesin-like protein KIF18A
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001199426
PolypeptideNP_001186355
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.39412
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly39068FBgn0004379
Human81930ENSG00000121621MIM:611271
Mouse228421ENSMUSG00000027115All phenotypic alleles (1):Targeted, knock-out(1) MGI:2446977
Xenopus548999, 398650990469
Zebrafish393209ENSDARG00000008022ZDB-GENE-040426-862ZFIN:ZDB-GENE-040426-862
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421607
Ensembl Gene
KEGGgga:421607
GEISHA IdKIF18A.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerATTGGCTGCATCGCGTTG
Reverse cDNA Template PrimerTTTCCTGAAGGCCTGCCAGcDNA Template Length708
Complete cDNA Template Probeshow
ATTGGCTGCATCGCGTTGAAAACGAAATGCGCCTCCTGAATCAAGATGGCTGTATTCCAAAGGAACTGCGTGAAGACCT
TCAGTGTTGCCACTTAAACCTAGAAGTTAAGGACCTGAAAGCCCAGATTGAACACATGTTATCTCTATTGTCCCTTCAA
GATCAACACTATAAGCAGATGGAAAAAGTTTTAAATGCTTTGCTTCCAGTTCTTCGCAAGCAGTACCTGATTTTGAAAG
AAGCTGGGTTGACAAATACTTTAACTGAGACTGAATTTGGAGAGGTAGAACAGCTGATTCAAAGACAAAAGTCAGTAGT
TTGGGCTGACCAGACTGGAGACGAGGAACAGAAAGAAAACCGTGAGCTAGATGTGTCAGCTATCTTTGCATTCCCACAA
CTTGTGAACAAACAAAACACCCCATGCCGTTCAACTTCTGGTACACCATCACAAGAAATGAAGAGAAATACACAACTAG
TGGAATATGTAGTACCACCACAGAAACGAACTAGGCGAAAGCTAATGGACTTTCCAGTCAAAACTCCGAGTCCTGCTGC
ATCCAAGCACTTCAGCCTCTGTCATTTGGAAGATTCTCTCAGCAAGGAAGTTCAGCCTATTGTGTATACACCAGAATCT
TGCAGAAAAACAATACAAAGCAGCTGTTCACAGACTGTGGTAAAACAAGCATTACACCTGGCAGGCCTTCAGGAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Unlabeled
 
19
stage 19
stage 19
Head Mesenchyme
Pharyngeal Arches and Clefts
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.39412

Mouse

Emage
EurexpressMGI:2446977
MGI GXDMGI:2446977

Frog

Xenbase990469

Fruit Fly

BDGPFBgn0004379

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-862
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona