GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CSRP2
cysteine and glycine rich protein 2

Gene
Official SymbolCSRP2
Official Full Namecysteine and glycine rich protein 2
CGNC ID7804
also known asBETA-CRP, CRP2, cysteine and glycine-rich protein 2|beta-cysteine-rich protein|cysteine-rich protein 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205208
PolypeptideNP_990539
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.665
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1466ENSG00000175183MIM:601871
Mouse13008ENSMUSG00000020186All phenotypic alleles (4):Targeted, knock-out(4) MGI:1202907
Xenopus549369, 447266, 447493943912
Zebrafish393871ENSDARG00000011961ZDB-GENE-040426-1863ZFIN:ZDB-GENE-040426-1863
Gene Ontology
Molecular Functionzinc ion binding
Biological Processcell differentiation, multicellular organismal development
Cellular Componentnucleus
Links to other databases
Entrez Gene396128
Ensembl Gene
KEGGgga:396128
GEISHA IdCRP2.Bonnin.2002Data SourcePublication
Complete cDNA Template Probeshow
GTGCGGAGCGGAGCCTGTGCACTGCCATGCCGAACTGGGGAGGTGGCAACAAATGTGGTGCCTGCGGCCGGACGGTCTA
CCATGCTGAGGAGGTGCAGTGCGACGGACGGAGCTTCCATCGCTGCTGCTTCCTCTGCATGGTTTGCAGGAAGAATTTG
GACAGCACAACTGTTGCGATTCACGATGCTGAAGTTTACTGCAAATCTTGCTATGGAAAGAAGTACGGCCCAAAAGGTT
ACGGCTATGGGCAAGGGGCGGGCACGCTGAACATGGACAGGGGAGAGAGACTAGGCATCAAGCCTGAGAGCACACCCTC
TCCTCACCGACCCACCACAAACCCAAATACTTCAAAATTCGCTCAGAAGTTTGGAGGTGCAGAGAAATGTTCTCGGTGT
GGGGATTCTGTTTATGCGGCGGAGAAAGTCATAGGTGCTGGAAAGCCATGGCACAAGAACTGCTTCCGATGTGCCAAGT
GTGGGAAAAGTCTAGAATCTACAACCCTAACTGAAAAAGAGGGAGAAATCTACTGTAAAGGCTGTTACGCAAAGAACTT
CGGCCCTAAAGGATTTGGCTATGGTCAGGGAGCAGGAGCCCTCGTTCATGCCCAGTGAGGGAGTCCAGCGCAACCTGCA
CAGCTCTGCACAGATTCAGCTAAAGGAAAGTTTCCAAAATGTTACTAACCACTGTGACACAGATGCTAGTTGACTGTAG
TGTTTGGGCCATACTTTTAGATGGTTTTTTTTTTTTTTAAGCACTGCTTTCTTCCTTGCTTTATGTACCACACTTTTCA
TACTGTGTATCAGTTCAATAAAGC
CitationBonnin MA, Edom-Vovard F, Kefalas P, Duprez D. CRP2 transcript expression pattern in embryonic chick limb. Mech Dev. 2002 Aug;116(1-2):151-5.
CopyrightCopyright © 2002 Elsevier Science Ireland Ltd. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205208).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 21
stage 22
stage 22
Pronephros
Somites
Wing
Wing AER
Wing Mesenchyme
somites (blue arrow)
25-30
stage 25
stage 28
Somites
Wing
Wing AER
Wing Mesenchyme
 
31-44
stage 34
stage 34
stage 35
stage 35
stage 35
stage 35
stage 36
stage 36
stage 36
stage 36
stage 44
stage 44
stage 44
Wing
Wing Muscles
CRP2 in situ (blue)
MF20 immunostain (brown)
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.665

Mouse

EmageMGI:1202907
EurexpressMGI:1202907
MGI GXDMGI:1202907

Frog

Xenbase943912

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-1863
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona