GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

DACH1
dachshund family transcription factor 1

Gene
Official SymbolDACH1
Official Full Namedachshund family transcription factor 1
CGNC ID12712
also known asDACH, dachshund homolog 1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001199446
PolypeptideNP_001186375
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.79
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1602ENSG00000276644MIM:603803
Mouse13134ENSMUSG00000055639All phenotypic alleles (2):Targeted, knock-out(2) MGI:1277991
Xenopus779442, 779068980848
Zebrafish791191ENSDARG00000069440ZDB-GENE-070427-2ZFIN:ZDB-GENE-070427-2
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene373935
Ensembl Gene
KEGGgga:373935

Entry 1

GEISHA IdDACH1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-ACACGGTCTACACCAAGCTG-3’
Reverse cDNA Template Primer5’-AATTAACCCTCACTAAAGGACACACTGCTGCTTCGATGA-3’cDNA Template Length714
Complete cDNA Template Probeshow
ACACGGTCTACACCAAGCTGAAGCGCCTGGAGATCACGCCCGTGGTCTGCAACGTGGAGCAGGTCCGCATCCTGCGGGG
GCTGGGGGCCATCCAGCCCGGCGTCAACCGCTGCAAACTCATCTCCCGGAAGGATTTCGAGACCCTCTACAACGACTGC
ACCAACGCCAGTTCTAGACCTGGAAGGCCTCCTAAGAGGACTCAAAGTGTCACCTCTCCAGAGAATTCTCATATCATGC
CACATTCTGTCCCAGGCCTAATGTCTCCTGGAATCATCCCGCCAACAGGCTTGACAGCAGCAGCTGCAGCAGCAGCAGC
TGCCACCAATGCTGCCATAGCAGAAGCAATGAAAGTGAAAAAAATTAAATTGGAAGCTATGTCCAACTACCATGCAAAT
AATAACCAGCATGGAGCAGACTCTGAAAATGGAGATCTGAATTCAAGTGTTGGATTGGAGCTTCCATTTATGATGATGC
CCCACCCATTAATTCCTGTGAGCCTACCTCCAGCGTCTGTCACAATGGCAATGAGCCAGATGAATCACCTTAGTACCAT
TGCCAACATGGCAGCAGCAGCACAAGTGCAGAGTCCTCCATCCAGAGTTGAGACATCTGTTATTAAGGAACGTGTTCCA
GACAGCCCTTCTCCTGCTCCTTCTCTTGAAGAGGGCCGAAGACCTGGCAGCCACCCATCCTCTCATCGAAGCAGCAGTG
TGT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Unlabeled
 
7-12
stage 7
stage 10
stage 10
stage 11
stage 11
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Crest
Neural Plate/Tube
Pharynx
Primitive Streak
Somites
 
13-18
stage 16
stage 18
stage 18
stage 18
stage 18
Diencephalon
Ear/Otic Placode
Endoderm
Eye
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Midbrain
Nephric Ducts
Neural Plate/Tube
Oral Pharynx
Pharyngeal Arches and Clefts
Pharynx
Sclerotome
Somatic Mesoderm
Telencephalon
Ventricles
Wing Mesenchyme
infundibulum
nephrogenic mesenchyme
19-24
stage 22
stage 24
Cranial Ganglia
Ear/Otic Placode
Eye
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Mesencephalon
Mesonephros
Nasal Placode/Nerve
Neural Plate/Tube
Outflow Tract
Pharyngeal Arches and Clefts
Spinal Cord
Spinal Ganglia and Nerves
Wing Mesenchyme
 
25
stage 25
stage 25
stage 25
stage 25
Central Nervous System
Cranial Ganglia
Ear/Otic Placode
Eye
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Mesonephros
Midbrain
Pharyngeal Arches and Clefts
Spinal Cord
Spinal Ganglia and Nerves
Wing Mesenchyme
 

Entry 2

GEISHA IdDACH1.Litsiou.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGGCCGTTCCGGCTGCGCTGATCCCTCCGGCCCCGCTGGTCCCCCCTCAGCCTCCGGTCTCAACTTCTGCCGCCTGCA
CCACCACCACCACCACCTCCTCGGCGGCCGCCACCTCCTCTCCGGCTCCGGCCATCGCTCCCCCGCCGCCCGCCTCGGG
GACAAACCTATTCCGCCCGGAGCCCATCGCAGCGCCGGCGGCGGCGGCGGCCACAGTCACCTCCACCGCCACCACCACC
ACCACCGGAGGCAGCGGCGGAGGCGGCGGCAGCGGCGGCGGCGGCGGCAGCCCCAGCCTGGGCAGCGGCACCGGCGGCG
GCACCTCCGGCACCTCCACGCCCAACGCCGGCGCGGCCGGCAGCCTGCCCGGCAAGCCCGTGTACTCGACCCCGTCCCC
GGTGGAGAACACCCCCCAGAATAACGAGTGCAAGATGGTGGATCTGAGGGGGGCCAAAGTGGCCTCCTTCACCGTGGAG
GGCTGCGAGCTCATCTGCCTGCCCCAGGCGTTCGACCTCTTCCTGAAGCACTTGGTGGGGGGCTTGCACACGGTCTACA
CCAAGCTGAAGCGCCTGGAGATCACGCCCGTGGTCTGCAACGTGGAGCAGGTCCGCATCCTGCGGGGGCTGGGGGCCAT
CCAGCCCGGCGTCAACCGCTGCAAACTCATCTCCCGGAAGGATTTCGAGACCCTCTACAACGACTGCACCAACGCCAGT
TCTAGACCTGGAAGGCCTCCTAAGAGGACTCAAAGTGTCACCTCTCCAGAGAATTCTCATATCATGCCACATTCTGTCC
CAGGCCTAATGTCTCCTGGAATCATCCCGCCAACAGGCTTGACAGCAGCAGCTGCAGCAGCAGCAGCTGCCACCAATGC
TGCCATAGCAGAAGCAATGAAAGTGAAAAAAATTAAATTGGAAGCTATGTCCAACTACCATGCAAATAATAACCAGCAT
GGAGCAGACTCTGAAAATGGAGATCTGAATTCAAGTGTTGGATTGGAGCTTCCATTTATGATGATGCCCCACCCATTAA
TTCCTGTGAGCCTACCTCCAGCGTCTGTCACAATGGCAATGAGCCAGATGAATCACCTTAGTACCATTGCCAACATGGC
AGCAGCAGCACAAGTGCAGAGTCCTCCATCCAGAGTTGAGACATCTGTTATTAAGGAACGTGTTCCAGACAGCCCTTCT
CCTGCTCCTTCTCTTGAAGAGGGCCGAAGACCTGGCAGCCACCCATCCTCTCATCGAAGCAGCAGTGTGTCCAGCTCTC
CTGCACGGACTGAGAGCTCTTCAGACAGAATCCCTGTCCATCAGAATGGGCTATCTATGAACCAAATGCTGATGGGTTT
GTCACCTAATGTCCTTCCTGGGCCTAAAGAAGGTGATCTGGCTGGTCATGACATGGGACATGAGTCAAAAAGAATACAC
ATTGAGAAAGATGAGACCCCGCTCTCCACACCAACCGCAAGAGACAGCCTTGACAAACTTTCTCTAACTGGGCATGGGC
AACCACTACCTCCAGGTTTTCCATCTCCTTTTCTATTCCCTGATGGATTGTCCTCCATAGAGACCCTTCTGACTAACAT
CCAGGGTCTACTAAAGGTTGCTATAGACAATGCTAGAGCTCAAGAGAAACAAGTCCAACTGGAAAAGACAGAGCTGAAG
ATGGAGCTCTTCAGGGAACGAGAACTGAGGGAAACACTTGAAAAACAGTTGGCCGTGGAGCAGAAAAATAGAGCAATAA
TTCAGAAAAGGTTAAAGAAGGAAAAGAAGGCAAAGAGGAAATTGCAGGAAGCACTTGAATTCGAGACTAAACGACGGGA
GCAAGCAGAACAGACACTGAAACAAGCAGCTTCAACAGATAGTCTCAGGGTCCTAAATGACTCTCTGACCCCAGAGATA
GAAGCTGACCGCAGTGGGGGCAGAACAGATGCTGAAAGGACAATACAAGATGGAAGACTTTATTTGAAAACTACTGTCA
TGTATTGAATTTTTCCTGCTGAAGATACCTGTGCTACGGTAAAGAACTTTGCAGTAAGACATTCACCCAAATGGAGTTC
TGTGGGAACAAAATGTTTTCAACTTCATTTACCAATGTTCTTCAAAAATGTAAGGAATTCTGCAAGAGTGTCCTCCTTT
GGTTATCTCCTGTGGCTCAAGCCAGAGCTCTAGAGAATGTTTGTAAATGTACAGTAGCACTCTTCTTACAGTGAAAATC
TTCATCTGTGCACCGGACTATTGTACCAAAACTACAGGCAGGTCAGAACAAGGTTGAGTATTCCCTTTTTCAAGGAATG
CAGACTCTGTCCTCCTCTGATGATTCTATATTTGAGCACATCAAATGATCCTTCCAGCGGTGTCGAAGTACACTTACAG
ACTGTTATATCATACCGAAACCAGCAAGACAGCTCAGAAATGAACTTGTAGAGGGCATAAGAGGACTCTTATTTAAAAA
AAAAAAAGAAAAAAAGAAAAAAAGTAAAAA
CitationLitsiou A, Hanson S, Streit A. A balance of FGF, BMP and WNT signalling positions the future placode territory in the head. Development. 2005 Sep;132(18):4051-62. Epub 2005 Aug 10
CopyrightAuthors hold the copyright. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001199446.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Ectoderm
Neural Crest
 
7-8
stage 8
stage 8
Ectoderm
Neural Crest
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.79

Mouse

EmageMGI:1277991
EurexpressMGI:1277991
MGI GXDMGI:1277991

Frog

Xenbase980848

Fruit Fly

BDGP

Zebra Finch

ZEBrADACH1

Zebrafish

ZFINZDB-GENE-070427-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona