GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MYL3
myosin, light chain 3, alkali; ventricular, skeletal, slow

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolMYL3
Official Full Namemyosin, light chain 3, alkali; ventricular, skeletal, slow
CGNC ID49636
also known asMLC, MLC1c/1s, myosin light chain 1, cardiac muscle|cardiac muscle|light polypeptide 3|myosin alkali light chain|myosin light chain A1|myosin light chain alkali 1|myosin, light polypeptide 3, alkali; ventricular, skeletal, slow|slow skeletal ventricular myosin alkali light chain 3
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205159
PolypeptideNP_990490
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4198
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4634ENSG00000160808MIM:608751MIM:160790
Mouse17897ENSMUSG00000059741All phenotypic alleles (2):Targeted, other(2) MGI:97268
Xenopus394608, 398607, 398606, 100124786, 373844946569, 977610
Zebrafish100148520, 574004ENSDARG00000011519ZDB-GENE-050626-112ZFIN:ZDB-GENE-050626-112
Gene Ontology
Molecular Functioncalcium ion binding
Biological Process
Cellular Componentmyosin complex
Links to other databases
Entrez Gene396067
Ensembl GeneENSGALG00000005448
KEGGgga:396067
GEISHA IdMYL3.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
CTCTTGCCTGTCTGTGCCCTTCTTTCCAAAAGCAGCCCACCAGCAAGCACCATGCCTCCAAAGAAGCCTGAACCTAAGA
AGGCGCCTGAACCCAAGAAGGAAGAACCCAAACCAGCACCTAAGCCAGCAGAACCAGAGCCCAAAAAAGAAGTTGAATT
TAACCCAGCTTCTATCAAAGTTGAATTCACCCCTGATCAGATTGAAGAATTTAAGGAAGCGTTCTCACTTTTTGACCGT
ACTCCCAAATCTGAGATGAAGATCACATATGCGCAATGTGGAGATGTCTTGAGGGCTTTGGGGCAGAATCCAACCCAGG
CTGAGGTCATGAAGGTGCTTGGCAGACCCAAACAAGAAGAGATGAACTCCAAGATGATTGACTTTGAGACCTTCCTGCC
CATGCTCCAGCACATTTCCAAGACAAAAGACACAGGCACCTACGAGGACTTTGTGGAAGGTCTGCGTGTGTTTGACAAG
GAGGGAAATGGAACAGTGATGGGGGCTGAACTTCGCCATGTTCTGGCTACGCTGGGTGAAAGGTTGACTGAAGAGGAAG
TTGATAAGCTAATGGCTGGCCAGGAAGATGCCAATGGTTGTATCAACTATGAAGCTTTTGTGAAACATATCATGGCTAA
CTGAACACCAGCTTTGGAAGACACCACCTTTAACATGTGAGATGTAACGGATGAACAACACAAAACAAAGGTGAATGCT
TTACTGCTAGAATGCATCCCTTCTCTCTGTTCTCCAAAAGGATATATTCTCCTTTTAACAGTCTGGTCTATGACAAATG
AACTGTTTTATTTTTCCCAATGAAAACTTGAAATTGTTCCATTATGTATTTCCTGGCCCTGTTTTTCTTGCAGTAAAAC
ATGGGATTCTTTGGCAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST220a4. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Extraembryonic Mesoderm
Lateral Plate Mesoderm
 
7-12
stage 7
stage 8
stage 9
stage 10
stage 12
stage 12
Atria
Extraembryonic Mesoderm
Outflow Tract
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4198

Mouse

EmageMGI:97268
EurexpressMGI:97268
MGI GXDMGI:97268

Frog

Xenbase946569, 977610

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050626-112
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona