GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HS6ST3
heparan sulfate 6-O-sulfotransferase 3

Gene
Official SymbolHS6ST3
Official Full Nameheparan sulfate 6-O-sulfotransferase 3
CGNC ID53245
also known asheparan-sulfate 6-O-sulfotransferase 3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003640546
PolypeptideXP_003640594
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene428025
Ensembl Gene
KEGGgga:428025

Entry 1

GEISHA IdHS6ST3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGTTCTTTTCTGTAAACCCGCAGTC
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGGATAAGCAGCAATAACACCGTTGGcDNA Template Length1072
Forward cDNA Template Probeshow
AAAAAGAANCAGCAGGCATTGGAAAACAACATTTGGGAAATAAGGGGATAAATTTTCAAACTTGACTTCTTTTCCTGCA
GCACATTTAACTTTTAATGAGTGGCTAAAAACTTCAATTCTGAAAATAAGTGAGAAATGTGCATCCACATCAGGTACTC
CACTATCTCTAATTAGTAAATGTGTAAGGTAAAAGCCATTCATGCATGCAATAATATACTTTCAGCATCTCGATTTAGC
AGCCACGTTGAGGCACTTAGAGAAATTTCCTCCTAATGCTTTAGATTTATGCTAGAAGAAGGAGGAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 7
stage 11
Sinus Venosus
Unlabeled
Ventricles
 
13-18
stage 14
stage 14
stage 16
stage 16
stage 18
stage 18
stage 18
Dermomyotome
Ear/Otic Placode
Forebrain
Foregut
Heart
Hindbrain
Midbrain
Neural Plate/Tube
Notochord
Sinus Venosus
 
19-24
stage 22
stage 23
Sinus Venosus
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
 
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
Atria
Endocardium
Foregut
Leg Mesenchyme
Outflow Tract
Spinal Cord
Spinal Ganglia and Nerves
 

Entry 2

GEISHA IdHS6ST3.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
TGCGCATGCTGGCAGATCTCAGCCTGGTGGGATGCTACAACTTGACTTTTATGAACGAGACTGAGAGAAACGTGATTCT
TCTCCAAAGCGCCAAGAACAATCTGAAAAATATGGCCTTCTTTGGGCTGACAGAATTTCAGAGGAAAACACAGTATCTC
TTTGAGAGGACATTCAACCTGAAATTCATTTCCCCATTCACCCAGTTCAACGTCACACGGGCCTCCAATGTGGACATCG
GTGAGGATGTGCGGCGACGGATAGAGGAGCTGAACTTCTTAGACGTGCAGCTTTACGACTACGCCAAGGACCTGTTCTT
GCAGCGCTTCCAGTACTCCAAGCAAGAGGAACATCAGCTGAACCGCCTAAAGAGGCGAGAGGAGCGGAGGCTGCTGCGG
GAGCAGAGAGCTCACCAGTGGCCAAGGGAAGAGGCAGCAGAAGTAGCTGTTACTGAAGATTATAATAGCCAGGTTGCAC
GGTGGTAACGCTCCTCCATCTTGTCTAACCCATGGGAGGATCAGAGAGGCTGATTCTTTGTGCAGCTCGGCTGCCTGGA
AGTCAGCCAAGGAAGGCCAATCACCATAGTGAATGATACAGCATCTGACAGCTAACCTTCCTTGTATCAGTTTTTCTTG
CTTTCTGTCAGTAAGAAGAATATATTTTTTTTCTCCGTGTACATTCATTGGTGTTATTAATAGCAGTAGAAGAGATTCC
TATCCAAACAGACTTCCTTCCAAACCCTAAGCTGTGAGAATGGGTTGAAGAGAGAGCTGTGTCTATGACATTAACAGAC
GTACCCTCTACAATCTGAGCTACCAAAACTTGTGCAGACATGAATCAAAATTGAAAAAAAAAAAAAAAAAGTTTTGATG
CCTC
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST935c22. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Ear/Otic Placode
Forebrain
Foregut
Head Mesenchyme
Heart
Hindbrain
Intermediate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Somites
 
13
stage 13
Forebrain
Foregut
Head Mesenchyme
Heart
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Somites
 

Entry 3

GEISHA IdHS6ST3.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
TCTGCGCATGCTGGCAGATCTCAGCCTGGTGGGATGCTACAACTTGACTTTTATGAACGAGACTGAGAGAAACGTGATT
CTTCTCCAAAGCGCCAAGAACAATCTGAAAAATATGGCCTTCTTTGGGCTGACAGAATTTCAGAGGAAAACACAGTATC
TCTTTGAGAGGACATTCAACCTGAAATTCATTTCCCCATTCACCCAGTTCAACGTCACACGGGCCTCCAATGTGGACAT
CGGTGAGGATGTGCGGCGACGGATAGAGGAGCTGAACTTCTTAGACGTGCAGCTTTACGACTACGCCAAGGACCTGTTC
TTGCAGCGCTTCCAGTACTCCAAGCAAGAGGAACATCAGCTGAACCGCCTAAAGAGGCGAGAGGAGCGGAGGCTGCTGC
GGGAGCAGAGAGCTCACCAGTGGCCAAGGGAAGAGGCAGCAGAAGTAGCTGTTACTGAAGATTATAATAGCCAGGTTGC
ACGGTGGTAACGCTCCTCCATCTTGTCTAACCCATGGGAGGATCAGAGAGGCTGATTCTTTGTGCAGCTCGGCTGCCTG
GAAGTCAGCCAAGGAAGGCCAATCACCATAGTGAATGATACAGCATCTGACAGCTAACCTTCCTTGTATCAGTTTTTCT
TGCTTTCTGGTCAGTAAGAAGAATATATTTTTTTCTCCGGTGTACATTCATTGGTGTTATTAATAGCAGTAGAAGAGAT
TCCTATCCAAACAGACTTCCCTTCAAACCCTAAGCTGTGAGAATGGGTTTGAAGAGAGAGCTTGGGTCTATGACN
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
Ventricles
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona