GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

BORCS8
BLOC-1 related complex subunit 8

Gene
Official SymbolBORCS8
Official Full NameBLOC-1 related complex subunit 8
CGNC ID52843
also known asMEF2BNB, BLOC-1-related complex subunit 8|MEF2B neighbor
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001256506
PolypeptideNP_001243435
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.7319
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human729991ENSG00000064489
Mouse72368All phenotypic alleles (2):Targeted, other(2) MGI:1919618
Xenopus100490313, 1006165385780710
Zebrafish558180ENSDARG00000071339ZDB-GENE-050208-757ZFIN:ZDB-GENE-050208-757
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene426622
Ensembl Gene
KEGGgga:426622

Entry 1

GEISHA IdBORCS8.Anderson.2020Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GGGTGGCGGCGCCGCTGGTTTTGGCTGGAGAGGGATGGAGGAGCCCGAGATGCTAGCTGAAGGTGAAGAAAGTTACAGA
CAAATTCACAGAGAGCATGTATGTGCTGGCCAACGAGCCCTCTGTGGCCCTGTACCGACTCCAGGAGCACGTCCGGCGA
TCGCTTCCAGAGCTCGCTCAGCACAAGTCTGACATGCAGAGCTGGGAGGAGCAGAGCCAAGGAGCCATCTACACCGTGG
AGTACGCCTGCAGTGCCATAAAGAGCATGACCGACAGCAGTGTGTACTTCAAGAGCATTGACAGTCTGCTCAAGCATGC
CATTGCCATGAAGGATCAGCTGAACGCCGCTCAGGGCCGCAGTGCTGTTGCCCCACAAGCCAAGAATCCTCCAGGTAGT
TCCTGATTTCAGACAAGACTGGCTGTCCTCTGCCTTCTTCTCTGGCCCAGCTCTGTGTTCTCTGACCACGTGGAGGAAT
AAGAAACCTGCTAAGTCTGTGAAGCTGCACAGAGGCCTGTGCCTGCCTCGGTTCCCAGTAACAAGGTGGTGCATCTGAG
CAGGAAAACCCTGCCACCGGGTTCAGAACTGCCTATGGGGGGTGCTTTGGGGAGCAGTCGTATCCCTTTCCACAGTGGG
AAGGGAAATGGGGTGGTTCTGCATTTGTCCTTTCCAGTTCTTTTTGATGGCGGACTGCTAGGAGACATTTTTCCTCTCT
AACCTTTGGCCACAAAAATCTCTCAGAAAAAAACTAGGTCTTACTTTCATCTCACGTTTTGTAGTTGGCTGTGTCCAGA
CTGAATTTAGGCACACTTCAGCCTTGTTCGGGGGGGTGTTCTGCAAGGAGAGCTTTCGTGTGTGTGCCAAAGAGTCGCT
GAGTTGGCTTAGTGAGAACAATAATAAAAAGGAAAGACCACA
CommentsImages Provided by Claire Anderson; Related article: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
Atria
Dermomyotome
Ectoderm
Endoderm
Lateral Plate Mesoderm
Myocardium
Neural Plate/Tube
Notochord
Outflow Tract
Pharynx
Sclerotome
Ventricles
Widespread Expression
extraembryonic endoderm
extraembryonic mesoderm
rostral dorsal mesocardium

Entry 2

GEISHA IdBORCS8.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GGGTGGCGGCGCCGCTGGTTTTGGCTGGAGAGGGATGGAGGAGCCCGAGATGCTAGCTGAAGGTGAAGAAAGTTACAGA
CAAATTCACAGAGAGCATGTATGTGCTGGCCAACGAGCCCTCTGTGGCCCTGTACCGACTCCAGGAGCACGTCCGGCGA
TCGCTTCCAGAGCTCGCTCAGCACAAGTCTGACATGCAGAGCTGGGAGGAGCAGAGCCAAGGAGCCATCTACACCGTGG
AGTACGCCTGCAGTGCCATAAAGAGCATGACCGACAGCAGTGTGTACTTCAAGAGCATTGACAGTCTGCTCAAGCATGC
CATTGCCATGAAGGATCAGCTGAACGCCGCTCAGGGCCGCAGTGCTGTTGCCCCACAAGCCAAGAATCCTCCAGGTAGT
TCCTGATTTCAGACAAGACTGGCTGTCCTCTGCCTTCTTCTCTGGCCCAGCTCTGTGTTCTCTGACCACGTGGAGGAAT
AAGAAACCTGCTAAGTCTGTGAAGCTGCACAGAGGCCTGTGCCTGCCTCGGTTCCCAGTAACAAGGTGGTGCATCTGAG
CAGGAAAACCCTGCCACCGGGTTCAGAACTGCCTATGGGGGGTGCTTTGGGGAGCAGTCGTATCCCTTTCCACAGTGGG
AAGGGAAATGGGGTGGTTCTGCATTTGTCCTTTCCAGTTCTTTTTGATGGCGGACTGCTAGGAGACATTTTTCCTCTCT
AACCTTTGGCCACAAAAATCTCTCAGAAAAAAACTAGGTCTTACTTTCATCTCACGTTTTGTAGTTGGCTGTGTCCAGA
CTGAATTTAGGCACACTTCAGCCTTGTTCGGGGGGGTGTTCTGCAAGGAGAGCTTTCGTGTGTGTGCCAAAGAGTCGCT
GAGTTGGCTTAGTGAGAACAATAATAAAAAGGAAAGACCACA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Atria
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.7319

Mouse

EmageMGI:1919618
EurexpressMGI:1919618
MGI GXDMGI:1919618

Frog

Xenbase5780710

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050208-757
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona