GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KCNH6
potassium voltage-gated channel subfamily H member 6

Gene
Official SymbolKCNH6
Official Full Namepotassium voltage-gated channel subfamily H member 6
CGNC ID49933
also known aserg, potassium voltage-gated channel subfamily H member 6|HERG protein|eag-related protein|ether-a-go-go-related gene potassium channel|ether-a-go-go-related protein|potassium voltage-gated channel, subfamily H (eag-related), member 6|voltage-gated potassium channel subunit Kv11.2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418075
PolypeptideXP_418075
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.55796
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human81033ENSG00000173826MIM:608168
Mouse192775ENSMUSG00000001901All phenotypic alleles (3):Targeted, knock-out(2) Targeted, other(1) MGI:2684139
Xenopus100491983990942, 983103
Zebrafish405763ENSDARG00000001803ZDB-GENE-040702-5ZFIN:ZDB-GENE-040702-5
Gene Ontology
Molecular Functionvoltage-gated potassium channel activity
Biological Process
Cellular Componentintegral component of membrane
Links to other databases
Entrez Gene414871
Ensembl GeneENSGALG00000000505
KEGGgga:414871

Entry 1

GEISHA IdKCNH6.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GAGGCACAGTGTGGCTGGCTTCCNAGATCAACATTTTCCAGCGGTTCCCATAGGGTAGATTTAATTTGCACATTCTAGT
GAACCCAGAGCAGTTCTTTCTTATGGCCACCAACAGGCTGGCTAGGCCTAACAGCACCCACCACCTCTTCCTTGCCGAG
GCTTCCTCTCGAGAACAGCACAAGCCCAGTGAGCCACAGCATCGAGAGGGGAGCGAACGCACAGCTTCCAGCTGCAAGG
CCACTTTGCTGTCAGCTCTTTGGAGCAGGGACCATTGTGTTGGTACTGGGCTTTGCCCAGTAGAGCCCATGGGCACTAC
AAAAGAGTATTCACCGGAGGAGGAGGAGAGCTCCACAGTGCAGTACTGGGGAGAGCTGCAGGTGGGAAGCCCAGGCCAA
GGACAGAAGCTCTCCCTGTCCTACCTGATGGCCACTGAGACACCAAGGGCCAACAACCCCTGCCACTTCAGCACGCTTC
AGCACAAGTCCTAGGGCACTGACTTCTCCAGCAAGGCCAACTGCGCCTTGCAGACCCCAACACGCATCCCACAAATCCC
CATACAAACCTGGCTGGTCATCGACCTGGACATAAAGCACAAAACTCAAAAGCACAATCCCAGAAAGCTGAAAAGCCAC
AGAGACTTCACGTCCAGTCCTTCCTCCCAGCTTCTCTCTTTTGATAAAGGTTTGATAGATGCTTCCTCCTCCCCATCCC
CTTTCCCTGGCAGACTCCCCCAGCATCCCGTAGGAGAAGCCCACTTAGCACTGCCGCCTTGCCGTTCGGTTAGATGCTG
TGACCGTCCTAGGCCGCCTGCTCAAGTAACATATTGAGCTCCCTTTGAGAGTAGTAAAACTGTGAGCATCTCTTTCTCT
GGAGTTTTAGTGTACACTTTGCTAATAAAGATGTTTTTGGCACC
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST674p14. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 11
stage 12
stage 12
Amnion
Anterior Intestinal Portal
Atria
Central Nervous System
Ear/Otic Placode
Forebrain
Head Mesenchyme
Heart Tube
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Oral Pharynx
Outflow Tract
Pharynx
Sinus Venosus
Somites
Ventricles
HH12+

Entry 2

GEISHA IdKCNH6.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GCACAGTGTGGCTGGCTTCCAAGATCAACATTTTCCAGCGGTTCCCATAGGGTAGATTTAATTTGCACATTCTAGTGAA
CCCAGAGCAGTTCTTTCTTATGGCCACCAACAGGCTGGCTAGGCCTAACAGCACCCACCACCTCTTCCTTGCCGAGGCT
TCCTCTCGAGAACAGCACAAGCCCAGTGAGCCACAGCATCGAGAGGGGAGCGAACGCACAGCTTCCAGCTGCAAGGCCA
CTTTGCTGTCAGCTCTTTGGAGCAGGGACCATTGTGTTGGTACTGGGCTTTGCCCAGTAGAGCCCATGGGCACTACAAA
AGAGTATTCACCGGAGGAGGAGGAGAGCTCCACAGTGCAGTACTGGGGAGAGCTGCAGGTGGGAAGCCCAGGCCAAGGA
CAGAAGCTCTCCCTGTCCTACCTGATGGCCACTGAGACACCAAGGGCCAACAACCCCTGCCACTTCAGCACGCTTCAGC
ACAAGTCCTAGGGCACTGACTTCTCCAGCAAGGCCAACTGCGCCTTGCAGACCCCAACACGCATCCCACAAATCCCCAT
ACAAACCTGGCTGGGTCATCGACCTGGACATAAAGCACAAAACTCAAAAGCACAATCCCAGAAAAGCTGAAAAGCCACA
GAGACTTCACGTCCAGTCCTTCCTCCCAGCTTCTCTCTTTTGATAAAGGTTCGATAGATGCTTCCTCCTCCCCATCCCC
TTTCCCTGGCAGACTCCCCCAGCATCCGTAGGAGAAGCCCCACTTAGCACTGCCGCCTTGCCGTTCGGTTAGATGCTGT
GACCGTCCTAGGCCGCTGCTCGAGTACATATTGAGCTCCCTTGAGAGTAGTAAACTGTGGAGCATCTCTTCTCTGGAGT
TTAGTGTACACTTGCTAATAAGAT
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.55796

Mouse

EmageMGI:2684139
EurexpressMGI:2684139
MGI GXDMGI:2684139

Frog

Xenbase990942, 983103

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040702-5
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona