GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MYL1
myosin, light chain 1, alkali; skeletal, fast

Gene
Official SymbolMYL1
Official Full Namemyosin, light chain 1, alkali; skeletal, fast
CGNC ID49821
also known asMLC, MLC-1, MLC-3, myosin light chain 1, skeletal muscle isoform|alkali myosin light chain 1|alkali myosin light chain 3|light polypeptide 1|myosin a1|myosin light chain 1f|myosin light chain 3, skeletal muscle isoform|myosin light chain 3f|myosin light chain A1|myosin light chain A2|myosin light chain alkali 1|myosin light chain alkali 2|myosin, light polypeptide 1, alkali; skeletal, fast|skeletal muscle isoform|skeletal-muscle myosin L-1 light chain|skeletal-muscle myosin L-4 light chain
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001044632
PolypeptideNP_001038097
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4835
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4632ENSG00000168530MIM:160780
Mouse17901ENSMUSG00000061816All phenotypic alleles (3):Targeted, knock-out(1) Targeted, other(2) MGI:97269
Xenopus394551, 379944970332
Zebrafish336165ENSDARG00000014196ZDB-GENE-030131-8109ZFIN:ZDB-GENE-030131-8109
Gene Ontology
Molecular Functioncalcium ion binding
Biological Processmuscle contraction
Cellular Componentmyofibril, myosin complex
Links to other databases
Entrez Gene396470
Ensembl GeneENSGALG00000002907
KEGGgga:396470
GEISHA IdMYL1.Anderson.2022Data SourcePublication
Complete cDNA Template Probeshow
TTGCGGCTCGAGCATTTGTAAAGCACATCATGTCTGTCTAAGTGGACGTCCCCAGATAACAAATGAACAAGTTGAATTC
GGAAAGACCAGATGGCACCTAAGATCTGCCTGAGTGAAATTCTTGCTCTGGCAGTCATCATCAACATGGAAACTGCGTA
GGACTGGACAATATGCCTCCAAACCCACTACTTTTCTTTTAACCAGTGCATCCATAGGCATTGCCTCTGGGTCACTTCC
AAAAACTGAACTTTCACCAGGGAGAGTTAGATGGAAAAACTGCCACTGTCCAGCACTCATCCATCCCAAACATCTCTTT
CCATGTTGTTTCCCATGAAAGAATGTAAACCTCTGGAAAAATAAAGCATCAGTAAATCCCTGTTGTACACTTTGAGGCT
ATAAAGTCTTTTTTACCCCCTCTAAACCTACTCAAACAAGAACTCAGCACTTAATTTATTTCTGTACGTCGTACTTCAC
AAAATAAAGTTTTAGAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST910o13. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Atria
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Crest
Neural Plate/Tube
Outflow Tract
Somites
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4835

Mouse

EmageMGI:97269
EurexpressMGI:97269
MGI GXDMGI:97269

Frog

Xenbase970332

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-8109
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona