|
MOS MOS proto-oncogene, serine/threonine kinaseGene | Official Symbol | MOS | Official Full Name | MOS proto-oncogene, serine/threonine kinase | CGNC ID | 53396 | also known as | c-mos, serine/threonine-protein kinase mos|oocyte maturation factor Mos|v-mos Moloney murine sarcoma viral oncogene homolog | gene type | protein-coding |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Gene Ontology | | Links to other databases | |
GEISHA Id | CHKMOS.Elis.2008 | Data Source | Publication | Complete cDNA Template Probe | show TACTCGTGTGACATCGTGACTGGCTTAGCCTTCCTTCACTCGCAGGGCATCGTGCACCTCGACCTGAAGCCTGCCAATA TCCTCATCACTGAGCACGGAGCGTGCAAGATCGGAGACTTCGGCTGCTCCCAGAGACTGGAGGAGGGCTTGTCCCAGAG CCACCATGTTTGCCAGCAA | Citation | Elis S, Batellier F, Couty I, Balzergue S, Martin-Magniette ML, Monget P, Blesbois E, Govoroun . Search for the genes involved in oocyte maturation and early embryo development in the hen. BMC Genomics. 2008; 9: 110. | Copyright | Copyright © 2008 Elis et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. | Comments | Authors indicated chkmos probe was isolated using primers forward:TACTCGTGTGACATCGTGACTGGC and reverse:TTGCTGGCAAACATGGTGGC from NCBI acc# NM_001031516 |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 1 |
 | stage 1 |  | stage 1 | | Ovary
|
| Data from NCBI Unigene EST Profile Unigene ID: Gga.32094 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|