GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HEG1
heart development protein with EGF like domains 1

Gene
Official SymbolHEG1
Official Full Nameheart development protein with EGF like domains 1
CGNC ID8958
also known asprotein HEG homolog 1|HEG homolog 1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_422104
PolypeptideXP_422104
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene424257
Ensembl Gene
KEGGgga:424257

Entry 1

GEISHA IdHEG1.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GANCCTGTCTCCTGGGACACCTTTGGGAGCAGGGGCCACCGTGTCCTCCGCAGACCTGCTGCTTGCTGATGCGGGCAGT
GCTTCCACGCCCTCTCACGGCAGTCAAGAGCCCAGGAGCATCCCAACTGCTGGAGAGGTGATGCTGCACTCAGACGTGT
CCACTGCGCTCAACAACATGACAATGGGGACACTGGGTTCCTCTCCGAGCTCTGCCACCAGCCCTGACCCCACCAGCAT
TTCAGGGGACACTTTGTCCTCCTCGGGAGCTGGGACACATGGAGCTGGCAGCTGGCAGGGAGACCTCATTACACATCCC
CGAGAACCTTTGCTTGCCAGCTCGCACTCTGCCTCCGGAAGTACATTTGCAGGTGTCAGAAGCAGCCACCAGCCAACTG
ACATGTCAACAATAGAGGAA
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST476a7. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Anterior Intestinal Portal
Aorta
Atria
Blood Islands
Ear/Otic Placode
Forebrain
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Sinus Venosus
Somites
Ventricles
 

Entry 2

GEISHA IdHEG1.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GGACCCTGTCTCCTGGGACACCTTTGGGAGCAGGGCCACCGTGTCCTCCGACAGACCTGCTGTCTTGCTGATGCGGGCA
GTGCTTCCACGCCCTCTCACGGACAGTCAAGAGCCCAGGAGCATCCCAACTGCTGCAGAGGTGATGCTGCACTCAGACG
TGTCCACTGCGCTCAACAACATGACAATGGGGACACTGGGTTCCTCTCCGAGCTCTGCCACCAGCCCTGACCCCACCAG
CATTTCAGGGGACACTTTGTCCTCCTCGGGAGCTGGGACACATGGAGCTGGCAGCTGGCAGGGAGACCTCATTACACAT
CCCCGAGAACCTTTGCTTGCCAGCTCGCACTCTGCCTCCGGAAGTACATTTGCAGGTGTCAGAAGCAGCCACCAGCCAA
CTGACATGTCAACAATAGAGGAAATGACTATTTTGTAAAAGACTTTTAGTGTACGACACAGCTGTGTCCAACTGTATAT
AGCGGCCGACTAGTTTTCTTTTATGATTTTTACTTTCTTTTTTTGCCATTCATGTTACGAATGTGGAATTGTGTTTATA
CAAAGTTTATTTGTATAATTTCATGTTAAAGGATTCTCTAATAAATGCTTCCTGAAGTGAACGTAGCCTCCAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Unlabeled
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona