|                      | 
                  ID1 inhibitor of DNA binding 1, HLH protein| Gene | | Official Symbol | ID1 |  | Official Full Name | inhibitor of DNA binding 1, HLH protein |  | CGNC ID | 4662 |  | also known as | DNA-binding protein inhibitor ID-1|helix-loop-helix protein|inhibitor of DNA binding 1, dominant negative helix-loop-helix protein |  | gene type | protein-coding |  
  |  | Genomic Map |  |  | Sequence Information |  |  | Gene Expression |  |  | Orthology |  |  | Gene Ontology | | Molecular Function |  |  | Biological Process |  |  | Cellular Component |  |  
  |  | Links to other databases |  |  
  
| GEISHA Id | ID1.Buchtova.2010 | Data Source | Publication |  | Complete cDNA Template Probe | show CATGAAGGGCTGCTACTCGCGACTCCGGGCGCTGGTGCCCACGCTGCCGCGGCACCGGAGGGTCTCTAAAGTGGAGCTC CTGCAGCACGTGATCGACTACATCTGGGACCTGCAGCTGGCGCTGCAGCCCGGCCCTCCCCGACCCCCCGCTGCTGCTG AGCCTCCCGAGGCTCCGTGCATGGCCGCTGCCGACCGCATACTGTGCCGCTGAGAGAGA  |  | Citation | Buchtová M, Kuo WP, Nimmagadda S, Benson SL, Geetha-Loganathan P, Logan C, Au-Yeung T, Chiang E, Fu K, Richman JM. Whole genome microarray analysis of chicken embryo facial prominences. Dev Dyn. 2010 Feb;239(2):574-91. |  | Copyright | Copyright © 19992011 John Wiley & Sons, Inc. All Rights Reserved. |  | Comments | The probe for ID1-a was amplified by PCR using the following primers: 5′-CATGAAGGGCTGCTACTCG-3′ and 5′-CCCAGATGTAGTCGATCACG-3′. The probe for ID1-b was amplified by PCR using the following primers: 5′-ATCGACTACATCTGGGACCTG-3′ and 5′-TCTCTCTCAGCGGCACAGTA-3′. |  
  
MouseFrogFruit FlyZebra FinchZebrafish 
 
 |  
  |