|
ID1 inhibitor of DNA binding 1, HLH proteinGene | Official Symbol | ID1 | Official Full Name | inhibitor of DNA binding 1, HLH protein | CGNC ID | 4662 | also known as | DNA-binding protein inhibitor ID-1|helix-loop-helix protein|inhibitor of DNA binding 1, dominant negative helix-loop-helix protein | gene type | protein-coding |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | ID1.Buchtova.2010 | Data Source | Publication | Complete cDNA Template Probe | show CATGAAGGGCTGCTACTCGCGACTCCGGGCGCTGGTGCCCACGCTGCCGCGGCACCGGAGGGTCTCTAAAGTGGAGCTC CTGCAGCACGTGATCGACTACATCTGGGACCTGCAGCTGGCGCTGCAGCCCGGCCCTCCCCGACCCCCCGCTGCTGCTG AGCCTCCCGAGGCTCCGTGCATGGCCGCTGCCGACCGCATACTGTGCCGCTGAGAGAGA | Citation | Buchtová M, Kuo WP, Nimmagadda S, Benson SL, Geetha-Loganathan P, Logan C, Au-Yeung T, Chiang E, Fu K, Richman JM. Whole genome microarray analysis of chicken embryo facial prominences. Dev Dyn. 2010 Feb;239(2):574-91. | Copyright | Copyright © 19992011 John Wiley & Sons, Inc. All Rights Reserved. | Comments | The probe for ID1-a was amplified by PCR using the following primers: 5′-CATGAAGGGCTGCTACTCG-3′ and 5′-CCCAGATGTAGTCGATCACG-3′. The probe for ID1-b was amplified by PCR using the following primers: 5′-ATCGACTACATCTGGGACCTG-3′ and 5′-TCTCTCTCAGCGGCACAGTA-3′. |
| Data from NCBI Unigene EST Profile Unigene ID: Gga.892 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|