GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GJD2
gap junction protein delta 2

Gene
Official SymbolGJD2
Official Full Namegap junction protein delta 2
CGNC ID7480
also known asCx35.1, gap junction delta-2 protein|connexin 35.1|connexin 36|gap junction channel-forming protein|gap junction membrane channel protein alpha 9|gap junction protein, delta 2, 36kDa
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204582
PolypeptideNP_989913
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.96
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human57369MIM:607058
Mouse14617ENSMUSG00000068615All phenotypic alleles (7):Targeted, knock-out(2) Targeted, other(5) MGI:1334209
Xenopus100496736489802
Zebrafish378444ZDB-GENE-030911-1, ZDB-GENE-111020-17ZFIN:ZDB-GENE-030911-1, ZFIN:ZDB-GENE-111020-17
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395273
Ensembl Gene
KEGGgga:395273

Entry 1

GEISHA IdGJD2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-CCACCAAAGAGGCAGAACC-3’
Reverse cDNA Template Primer5’-AATTAACCCTCACTAAAGGGCAGCTAGTTCAGTAAGTGC-3’cDNA Template Length621
Complete cDNA Template Probeshow
CCACCAAAGAGGCAGAACCAGACTGCTTAGAAGTGAAGGAGATCCCCAATCCTGCGATCAGAACTACAAAATCAAAGAT
GAGGAGGCAAGAAGGCATTTCTCGATTTTATATCATCCAAGTGGTCTTTCGAAATGCCCTAGAGATTGGATTCTTAGTC
GGGCAGTATTTTCTGTATGGATTCAATGTCCCTTCCATGTACGAATGTGACAGATACCCTTGCATTAAAGAAGTAGAGT
GCTATGTCTCTAGACCCACTGAGAAGACTGTGTTCTTGGTGTTCATGTTTGCTGTCAGTGGCATATGTGTGGTGCTCAA
TTTGGCAGAACTGAACCACTTGGGCTGGAGAAAGATCAAAATGGCAGTGAGAGGAGTACAGGCAAAAAGGAAATCCATA
TACGAAATCAGAAATAAGGACCTGCCAAGAATGAGCATGCCTAACTTTGGCAGGACTCAGTCAAGTGACTCAGCTTATG
TGTGAGGCTGTGACAGAACTGAAACTTGGTGCCAGGTGGAACAGACCCAGACACCATTAGAGAAAGGTACATTGCTTAG
GCAAGCATTTTATCAAACCACCAAGAAAGCCATTAAGGTATTGGATCTGCACTTACTGAACTAGCTGC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 11
Unlabeled
 
13-18
stage 16
stage 18
Unlabeled
 
19-24
stage 24
stage 24
Blood Vessels
Heart
Pancreas
 
25
stage 25
Atria
Blood Vessels
Head Mesenchyme
 

Entry 2

GEISHA IdCX36.Berthoud.2004Data SourcePublication
Complete cDNA Template Probeshow
AGGAAGAAAGGGGTAGGAAGAAGTGAAGAGATCCCCTCCGCTTGCCAAAGTCTTTGTCTCCGGATGAACAGCGATGGGG
GAATGGACTATTCTAGAGAGGCTACTGGAAGCTGCCGTGCAGCAGCACTCTACTATGATAGGGAGGATCCTGCTGACCG
TGGTGGTGATCTTCAGGATCCTCATTGTGGCCATTGTAGGGGAGACGGTGTACGATGACGAGCAAACTATGTTTGTCTG
TAATACGCTGCAGCCAGGCTGCAATCAGGCTTGTTACGACCAAGCTTTCCCTATTTCTCACATAAGGTACTGGGTGTTC
CAGATCATCATGGTGTGCACTCCCAGCCTGTGCTTCATAACGTACTCTGTTCACCAGTCTGCTAAGCAGAGGGAACGGA
GGTACTCCACTGTCTTCCTCACCTTGGAGAGAGACCAGGATTCAATGAAGCGTGAGGACAGTAAGAAAATCAAGAACAC
GATTGTCAATGGGGTGCTGCAGAACACTGAGAACTCCACCAAAGAGGCAGAACCAGACTGCTTAGAAGTGAAGGAGATC
CCCAATCCTGCGATCAGAACTACAAAATCAAAGATGAGGAGGCAAGAAGGCATTTCTCGATTTTATATCATCCAAGTGG
TCTTTCGAAATGCCCTAGAGATTGGATTCTTAGTCGGGCAGTATTTTCTGTATGGATTCAATGTCCCTTCCATGTACGA
ATGTGACAGATACCCTTGCATTAAAGAAGTAGAGTGCTATGTCTCTAGACCCACTGAGAAGACTGTGTTCTTGGTGTTC
ATGTTTGCTGTCAGTGGCATTTGTGTGGTGCTCAATTTGGCAGAACTGAACCACTTGGGCTGGAGAAAGATCAAAATGG
CAGTGAGAGGAGTGCAGGCAAAAAGGAAATCCATATACGAAATCAGAAATAAGGACCTGCCAAGAATGAGCATGCCTAA
CTTTGGCAGGACTCAGTCAAGTGACTCAGCTTATGTGTGAGGCTGTGACAGAACTGAAACTTGGTGCCAGGTGGAACAG
ACCCAGACACCATTAGAGAAAGGTACATTGCTTAGGCAAGCATTTTATCAAACCACCAAGAAAGCCATTAAGGTATTGG
ATCTGCACTTACTGAACTAGCTGCAAAAATGCAGTGCTATGTAAAAGAC
CitationBerthoud VM, Singh R, Minogue PJ, Ragsdale CW, Beyer EC. Highly restricted pattern of connexin36 expression in chick somite development. Anat Embryol (Berl). 2004 Nov;209(1):11-8.
Copyright© Springer-Verlag 2004
CommentsThe paper gives the accession number AF458098, which is now called NM_204582.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 15
stage 15
Pancreas
Somites
 
19-24
stage 24
stage 24
stage 24
stage 24
Blood Vessels
Myotome
Somites
double labeled

Entry 3

GEISHA IdCX36.Hasan.2010Data SourcePublication
Complete cDNA Template Probeshow
AGGAAGAAAGGGGTAGGAAGAAGTGAAGAGATCCCCTCCGCTTGCCAAAGTCTTTGTCTCCGGATGAACAGCGATGGGG
GAATGGACTATTCTAGAGAGGCTACTGGAAGCTGCCGTGCAGCAGCACTCTACTATGATAGGGAGGATCCTGCTGACCG
TGGTGGTGATCTTCAGGATCCTCATTGTGGCCATTGTAGGGGAGACGGTGTACGATGACGAGCAAACTATGTTTGTCTG
TAATACGCTGCAGCCAGGCTGCAATCAGGCTTGTTACGACCAAGCTTTCCCTATTTCTCACATAAGGTACTGGGTGTTC
CAGATCATCATGGTGTGCACTCCCAGCCTGTGCTTCATAACGTACTCTGTTCACCAGTCTGCTAAGCAGAGGGAACGGA
GGTACTCCACTGTCTTCCTCACCTTGGAGAGAGACCAGGATTCAATGAAGCGTGAGGACAGTAAGAAAATCAAGAACAC
GATTGTCAATGGGGTGCTGCAGAACACTGAGAACTCCACCAAAGAGGCAGAACCAGACTGCTTAGAAGTGAAGGAGATC
CCCAATCCTGCGATCAGAACTACAAAATCAAAGATGAGGAGGCAAGAAGGCATTTCTCGATTTTATATCATCCAAGTGG
TCTTTCGAAATGCCCTAGAGATTGGATTCTTAGTCGGGCAGTATTTTCTGTATGGATTCAATGTCCCTTCCATGTACGA
ATGTGACAGATACCCTTGCATTAAAGAAGTAGAGTGCTATGTCTCTAGACCCACTGAGAAGACTGTGTTCTTGGTGTTC
ATGTTTGCTGTCAGTGGCATTTGTGTGGTGCTCAATTTGGCAGAACTGAACCACTTGGGCTGGAGAAAGATCAAAATGG
CAGTGAGAGGAGTGCAGGCAAAAAGGAAATCCATATACGAAATCAGAAATAAGGACCTGCCAAGAATGAGCATGCCTAA
CTTTGGCAGGACTCAGTCAAGTGACTCAGCTTATGTGTGAGGCTGTGACAGAACTGAAACTTGGTGCCAGGTGGAACAG
ACCCAGACACCATTAGAGAAAGGTACATTGCTTAGGCAAGCATTTTATCAAACCACCAAGAAAGCCATTAAGGTATTGG
ATCTGCACTTACTGAACTAGCTGCAAAAATGCAGTGCTATGTAAAAGAC
CitationHasan KB, Agarwala S, Ragsdale CW. PHOX2A regulation of oculomotor complex nucleogenesis. Development. 2010 Apr;137(7):1205-13.
CopyrightPublished by The Company of Biologists 2007. This material is protected by a copyright retained by the authors. Permission granted by Dr. Ragsdale.
CommentsAn insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (AF458098).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Midbrain
Additional anatomy: somatic and visceral motoneuron subnuclei, oculomotor complex,

Entry 4

GEISHA IdGJD2.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
AACATAAATACCAAGAACACAGTCTTCTCAGTGGGTCTAGAGACATAGCACTCTACTTCTTTAATGCAAGGGTATCTGT
CACATTCGTACATGGAAGGGACATTGAATCCATACAGAAAATACTGCCCGACTAAGAATCCAATCTCTAGGGCATTTCG
AAAGACCACTTGGATGATATAAAATCGAGAAATGCCTTCTTGCCTCCTCATCTTTGATTTTGTAGTTCTGATCGCAGGA
TTGGGGATCTCCTTCACTTCTAAGCAGTCTGGTTCTGCCTCTTTGGTGGAGTTCTCAGTGTTCTGCAGCACCCCATTGA
CAATCGTGTTCTTGATTTTCTTACTGTCCTCACGCTTCATTGAATCCTGGTCTCTCTCCAAGGTGAGGAAGACAGTGGA
GTACCTCCGTTCCCTCTGCTTAGCAGACTGGTGAACAGAGTACGTTATGAAGCACAGGCTGGGAGTGCACACCATGATG
ATCTGGAACACCCAGTACCTTATGTGAGAAATAGGGAAAGCTTGGTCGTAACAAGCCTGATTGCAGCCTGGCTGCAGCG
TATTACAGACGAACATGGTCTGCTCGTCGTCGTACAC
CommentsImages and probe sequence provided by Claire Anderson. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Atria
Intermediate Mesoderm
Somites
 

Entry 5

GEISHA IdGJD2.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GGTTCCGCCGCGCCGCGGCACGAGCCGAGCGGGCCGGGCCGGGCTCGGCCGCCGCAGAGCCCGGAGTAGAGTCGGGCCG
GGCCGAACCGGGCAGAGCCGAGCCGAGAGTCCTCGGAAGGGCTGCCGCGTCCAGCTGTCTTCCTACTACCGGACTGCAA
GCGGTAGAGGGAGGTTTCTCTCGTTCTATTTTTTATTTTTTATTTTTTTTTCTTTCTCCATCCCTTGCAACACAACAAA
ACGAAAAGAAAAAAGAAAAAAAAAAAAGGGAGGGGGGAGGAAGAAAGGGGTAGGAAGAAGTGAAGAGATCCCCTCCGCT
TGCCAAAGTCTTTGTCTCCGGATGAACAGCGATGGGGGAATGGACTATTCTAGAGAGGCTACTGGAAGCTGCCGTGCAG
CAGCACTCTACTATGATAGGGAGGATCCTGCTGACCGTGGTGGTGATCTTCAGGATCCTCATTGTGGCCATTGTAGGGG
AGACGGTGTACGATGACGAGCAAACTATGTTTGTCTGTAATACGCTGCAGCCAGGCTGCAATCAGGCTTGTTACGACCA
AGCTTTCCCTATTTCTCACATAAGGTACTGGGTGTTCCAGATCATCATGGTGTGCACTCCCAGCCTGTGCTTCATAACG
TACTCTGTTCACCAGTCTGCTAAGCAGAGGGAACGGAGGTACTCCACTGTCTTCCTCACCTTGGAGAGAGACCAGGATT
CAATGAAGCGTGAGGACAGTAAGAAAATCAAGAACACGATTGTCAATGGGGTGCTGCAGAACACTGAGAACTCCACCAA
AGAGGCAGAACCAGACTGCTTAGAAGTGAAGGAGATCCCCAATCCTGCGATCAGAACTACAAAATCAAAGATGAGGAGG
CAAGAAGGCATTTCTCGATTTTATATCATCCAAGTGGTCTTTCGAAATGCCCTAGAGATTGGATTCTTAGTCGGGCAGT
ATTTTCTGTATGGATTCAATGTCCCTTCCATGTACGAATGTGACAGATACCCTTGCATTAAAGAAGTAGAGTGCTATGT
CTCTAGACCCACTGAGAAGACTGTGTTCTTGGTGTTCATGTTTGCTGTCAGTGGCATATGTGTGGTGCTCAATTTGGCA
GAACTGAACCACTTGGGCTGGAGAAAGATCAAAATGGCAGTGAGAGGAGTACAGGCAAAAAGGAAATCCATATACGAAA
TCAGAAATAAGGACCTGCCAAGAATGAGCATGCCTAACTTTGGCAGGACTCAGTCAAGTGACTCAGCTTATGTGTGAGG
CTGTGACAGAACTGAAACTTGGTGCCAGGTGGAACAGACCCAGACACCATTAGAGAAAGGTACATTGCTTAGGCAAGCA
TTTTATCAAACCACCAAGAAAGCCATTAAGGTATTGGATCTGCACTTACTGAACTAGCTGCAAAAATGCAGTGCTATGT
AAAAGACTGAAAACAAACAAACAAACAAACAAAAAGACAAAAAACAGCTATAAAACCATGCTTGATCTAGCCTTACAGC
TACTATTATTGCTAATTTTCTTTCTAAAGATTGGATGCTATCTGTTGGTGGAGCGGCTTTTTGGTCATCATTAGGATGA
GTTTAAAGTTCGGACTGTCTGACTTATCTTTGTAAACATGTAGAATGTTCATATTAAAAATCTGCAAGGATACTCTATA
TGGGGTGGGATGGGGTGGGAGAAACTGTTGCGACGCGCAGATGTAAGCATGTTTTAAAAGGAGGGTAATTGCACTGTGA
CCACAGCTCAATCAGGACATCTGCTCTCACCTATTTCACGGATGTCTGATGTTATTTTGCTTGTCTACATCACAGAGTT
TATTCCTGGTGTGTATTACTAGCTATTTTCTAACATAGTTTGTGCATCATCTAGTTATGCTAAACAATAAATGCTGAAT
ATAATTTTGCCATTTATTGTTTGTCTATCCACACACACACCAGAGACCTTAATCATCTTATGTTAGTTGTGATCTACAA
AATATATCAGTACATTTCAGTTCATTACCTGATATGTGCACGAATAAGATGGAGTTGGTTCATGCTGGCCAAGTTACGT
ACTTACCTACAGTTACCTACGGTGACACCCATACCAAAGGAACAGAGTTCATTGCTTTTAACTGTGATTATATCACCTT
CTCTCTGCTCTTATTTATATAAGTGCCATACTTGAAACATCCAACTCTGTACTTAATCAGAAGGTTATCTTGGAATACC
AGCTGGAATAAAGTGATTTTATACTCTCCTTTGTTAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204582 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Atria
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.96

Mouse

EmageMGI:1334209
EurexpressMGI:1334209
MGI GXDMGI:1334209

Frog

Xenbase489802

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030911-1, ZDB-GENE-111020-17
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona