GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GATA6
GATA binding protein 6

Gene
Official SymbolGATA6
Official Full NameGATA binding protein 6
CGNC ID49785
also known asGATA-6, transcription factor GATA-6|GATA-6 transcription factor|GATA-binding factor 6
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205420
PolypeptideNP_990751
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2061
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2627ENSG00000141448MIM:601656
Mouse14465ENSMUSG00000005836All phenotypic alleles (11):Targeted, knock-out(5) Targeted, other(6) MGI:107516
Xenopus395062, 399082, 397845485062
Zebrafish58076ZDB-GENE-000622-1ZFIN:ZDB-GENE-000622-1
Gene Ontology
Molecular Functionchromatin binding, protein kinase binding, RNA polymerase II core promoter sequence-specific DNA binding, more...RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity, RNA polymerase II repressing transcription factor binding, zinc ion binding
Biological Processcardiac muscle cell differentiation, cardiac muscle hypertrophy in response to stress, more...cardiac vascular smooth muscle cell differentiation, cellular response to BMP stimulus, cellular response to gonadotropin stimulus, cellular response to hypoxia, Clara cell differentiation, endodermal cell fate determination, intestinal epithelial cell differentiation, in utero embryonic development, liver development, lung saccule development, male gonad development, negative regulation of apoptotic process, negative regulation of transcription from RNA polymerase II promoter, negative regulation of transforming growth factor beta1 production, negative regulation of transforming growth factor beta2 production, organ formation, outflow tract septum morphogenesis, pancreatic A cell differentiation, phospholipid metabolic process, positive regulation of angiogenesis, positive regulation of cardiac muscle cell proliferation, positive regulation of cardioblast differentiation, positive regulation of cell cycle arrest, positive regulation of transcription from RNA polymerase II promoter, response to drug, response to estrogen, tube morphogenesis, type B pancreatic cell differentiation, Type II pneumocyte differentiation
Cellular Componentnucleus, transcription factor complex
Links to other databases
Entrez Gene396390
Ensembl Gene
KEGGgga:396390
GEISHA IdGATA6.Chapman.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGTACCAGACCTTGGCCATCTCGGCCTCGCAGGGCCCCGCGCCCTACGACGGATCTCCGGGCGGCTTCATGCACTCCG
CGCCCAGCTCTCCCGTCTACGTGCCCACCACCCGCGTGGGCTCCGTGCTGCCCACGCTGCCCTACCTGCAGGGCGGCGG
CGCGGCCCAGCCCGGCCACGCTCCGGCCGGCCACGTCTGGTCGCAGCCGGCGGCCGAGAGCCCCTCGTACGGCGCCGCG
GGCGGCGCGCACCCCTCGGGCCGCTTCCCCTACTCGGCCAGCCCGCCCGTGGCCAACGGCGCCTCGCGGGAGCAGTACG
GCGGCGGCCTGGCGGCGAGGGAGCAGTACGGAGCGCTGCCGCGGCCGCTCAACGGCTCCTACCCGGCGCCCTACGCCTC
CTACGTGGGGCCGCAGCTCGGCCCCGCCTGGCCCGCGGCGCCCTTCGAGAACTCCGTGCTGCACTGCCTGCAGGGCCGC
GCCGCGCCCATCCCCGTGCGGGCTCCGAGCGCAGAGCTGCTGGAAGACCTCTCCGAGAGCCGCGAGTGCGTCAACTGCG
GCTCCATCCAGACCCCGCTGTGGAGGAGGGACGGCACCGGGAATTACCTGTGCAACGCCTGCGGGCTCTACACCAAAAT
GAACGGCCTGAGCCGGCCCCTCATCAAACCCCAGAAGAGAGTGCCCTCGTCGCGGCGGCTCGGCCTGTCCTGTGCCAAC
TGCCACACCACCACCACCACCCTCTGGCGCCGGAACGCCGAGGGTGAGCCCGTCTGCAACGCCTGCGGCCTCTACATGA
AGCTTCATGGGGTTCCCCGACCACTTGCTATGAAAAAAGAAGGAATTCAGACGAGGAAACGAAAACCTAAGAACATCAA
TAAGTCGAAGGCATGCTCTGGTAACAGCACTACTGCAGTTCCTATGACTCCAACATCTACGTCTTCTACTAACTCAGAT
GACTGTAGCAAAAACGCCTCCCCAAGCACGCAGCCGGCAGCCTCGGGGGCGAGCTCGTCAGTGATGTCCGGCCCAGGAG
AGAGCACCAGTCCCGAAAGCAGCAACCTTAAGTATTCAGGTCAAGATGGGCTGTACACAGGAGTCAGCCTGACCTCCAC
GGCCGAGGTGACGGCGTCCGTCAGGCAGGATCACTGGTGTGCCCTGGCTCTGGCGTGA
CitationChapman SC, Matsumoto K, Cai Q, Schoenwolf GC. Specification of germ layer identity in the chick gastrula. BMC Dev Biol. 2007 Jul 30;7:91.
Copyright© 2007 Chapman et al; licensee BioMed Central Ltd.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205420).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XIII
Kohler's Sickle
 
1-3
stage 1
stage 3
stage 3
stage 3
stage 3
stage 3
Early Endoderm
Early Mesoderm
Hypoblast
Kohler's Sickle
Primitive Streak
Stage 3b chicken embryo
Stage 3d chicken embryo
sagittal section of Fig. 1 (R).
sagittal section of Fig. 1 (U).
4
stage 4
stage 4
Early Endoderm
Early Mesoderm
Kohler's Sickle
lateral sickle horn
sagittal section of Fig.1 (W).
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2061

Mouse

EmageMGI:107516
EurexpressMGI:107516
MGI GXDMGI:107516

Frog

Xenbase485062

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-000622-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona