GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TNNI2
troponin I2, fast skeletal type

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolTNNI2
Official Full Nametroponin I2, fast skeletal type
CGNC ID4970
also known asTNI, troponin I, fast skeletal muscle|sTnI protein (aa 85-182)|troponin I type 2 (skeletal, fast)|troponin I, fast-twitch isoform|troponin I, skeletal, fast, Troponin I, fast skeletal muscle, Troponin I, fast-twitch isoform
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205417
PolypeptideNP_990748
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.700
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human7136ENSG00000130598MIM:601680MIM:191043
Mouse21953ENSMUSG00000031097All phenotypic alleles (1):Targeted, knock-out(1) MGI:105070
Xenopus496523, 379243478628
Zebrafish402809, 445029, 494164, 394068, 492493, 550249ENSDARG00000013752, ENSDARG00000029995, ENSDARG00000029069, ENSDARG00000005841, ENSDARG00000045592, ENSDARG00000035958ZDB-GENE-040718-80, ZDB-GENE-040801-9, ZDB-GENE-040625-119, ZDB-GENE-040426-970, ZDB-GENE-041114-60, ZDB-GENE-050417-49ZFIN:ZDB-GENE-040718-80, ZFIN:ZDB-GENE-040801-9, ZFIN:ZDB-GENE-040625-119, ZFIN:ZDB-GENE-040426-970, ZFIN:ZDB-GENE-041114-60, ZFIN:ZDB-GENE-050417-49
Gene Ontology
Molecular Functionactin binding, metal ion binding, troponin T binding
Biological Processpositive regulation of transcription, DNA-templated, skeletal muscle contraction
Cellular Componentnucleus, troponin complex
Links to other databases
Entrez Gene396386
Ensembl Gene
KEGGgga:396386
GEISHA IdcTnI.Kruithof.2006Data SourcePublication
Complete cDNA Template Probeshow
CGGACTCGGGTTCACAACCATCTAAAGCAAGATGTCTGATGAAGAGAAAAAGAGGAGGGCAGCCACCGCCCGGCGCCAG
CACCTGAAGAGTGCTATGCTCCAGCTTGCTGTCACTGAAATAGAAAAAGAAGCAGCTGCTAAAGAAGTGGAAAAGCAAA
ACTACCTGGCAGAGCATTGCCCTCCTCTGTCCCTCCCAGGATCCATGCAGGAACTTCAGGAACTGTGCAAAAAGCTTCA
TGCCAAGATAGACTCAGTGGATGAGGAAAGGTATGACACAGAGGTGAAGCTACAGAAGACTAACAAGGAGCTGGAGGAC
CTGAGCCAGAAGCTGTTTGACCTGAGGGGCAAGTTCAAGAGGCCACCTCTGCGCCGGGTGCGCATGTCTGCTGATGCCA
TGCTGCGTGCCCTGCTGGGCTCCAAGCACAAGGTCAACATGGACCTCCGGGCCAACCTGAAGCAAGTCAAGAAGGAGGA
CACGGAGAAGGAGAAGGACCTCCGCGATGTGGGTGACTGGAGGAAGAACATTGAGGAGAAATCTGGCATGGAGGGCAGG
AAGAAGATGTTTGAGGCCGGCGAGTCCTAAGCACTGGTCTCTCCACTCTTGCCATTACCACCCTCTTCCATCCCCTCCT
GAGCATGGCCACAGCTGTGATCATGGCCACCTCCCTGCCCTGAACCTCAACATGTCCTCACCATGCATTGAACCCACTG
ACTGGGTGCTGTTTCTCTGATTTTGTGAAGAGCTGCAGTCTGGAAGCAGCAGTGTAAATAAAGCTTTCATGGGAGAGGA
CitationKruithof BP, van Wijk B, Somi S, Kruithof-de Julio M, Pérez Pomares JM, Weesie F, Wessels A, Moorman AF, van den Hoff MJ. BMP and FGF regulate the differentiation of multipotential pericardial mesoderm into the myocardial or epicardial lineage. Dev Biol. 2006 Jul 15;295(2):507-22. Epub 2006 Apr 3.
CopyrightCopyright © 2006 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # NM_205417).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 16
Splanchnic Mesoderm
peri-proepicardium
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.700
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona