GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

GEM
GTP binding protein overexpressed in skeletal muscle

Gene
Official SymbolGEM
Official Full NameGTP binding protein overexpressed in skeletal muscle
CGNC ID11908
also known asGTP-binding protein GEM|Gem GTPase
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_213579
PolypeptideNP_998744
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.14455
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human2669ENSG00000164949MIM:600164
Mouse14579ENSMUSG00000028214All phenotypic alleles (2):Targeted, other(2) MGI:99844
Xenopus100038040483369
Zebrafish560566ENSDARG00000029112ZDB-GENE-060825-251ZFIN:ZDB-GENE-060825-251
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene404771
Ensembl Gene
KEGGgga:404771

Entry 1

GEISHA IdGEM.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GAGATCCCGAAGAAGCCAGGCGGTTTTGGGGCAAAATAGTTGCCAAGAACAACAAGAATATGGCCTTCAAACTCAAGTC
CAAGTCTTGTCATGACCTATCGGTACTTTAAGAACTTTGGACTCTGCCAGAGCTTTTGGCATTTTGTGGACATTATCGA
ACTATGTTGTGGGAAATAATCTATATTAGATTGGGCTATGAAAATGACTTAGATTCACAGTTGTGATCGTGATGATACG
TGCTGACATAAGAACAGCACAGTGCATGGAAATATCTCTCTTTCATTTTCTTTGTTTTAGTTTTGTAAGAAAAGTATAA
ACCAGAATGATCCGAAATTGTGCTGGGAAAGCATTCCGGAATATACCTATTTCTTCTCCACTCACCTTTGGATAATAGC
TTAAGAACCTCAAACTGTCATGACTTGGGAAGTGAATACTACACTCTTTACTCTTTCTCACTGTAATTACTCTTTTATT
TTTATTTTCTTTTCTGAAAATTGTGTAAAGAATTGAGGAACTGACCAGGCGTTGATCCCTCGCCAATTGGCTGGTCAGG
CTTGAGCACCCACAGCTGAAAATATGCATTGTTGTAGAATAGCCACCAGAACACTTCTTCTTATTATTTCGAGGATTGG
TTTCAATGAGTTTACACATCTCTTACTTTGAAAATATTTAAAGGAAAAATCCTATAGTCAAATATTTTTTTCCTCTCAT
ATTTCTATGTTAGGGGCCTGTTTAAAACTCATAGTCAAAATAAGATTAAAGCACAAGCTGTATCAAAGTACATCAAGTG
CAGGATGCCAAACCTTTATAAATCACCTGAGCTTTTCTAAGAAACCACACGGACTTCTTGTATCCAGTCTTGGCCTTTC
TCTGTGCCAGAGCTATGCTGTATTTATTGTTGTGCAAAATAACAAGCATTTTAATGTTGAGGGGAAATGTATTTATTAC
CAAGTTTCTTAAAGAATAATGTTAATTTTATTACTGTTTTCTATCTAATATCTTTTTTCAGATATGCAAGTTTTTACTT
ACATGCCTTGTAATAAAACAAATAAAATATATGACT
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST624g12.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Area Opaca
Blood Islands
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Notochord
Sinus Venosus
Somites
Ventricles
 

Entry 2

GEISHA IdGEM.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
ATCCCGAAGAAAGCCAGGCGGTTTTGGGGCAAAATAGTTGCCAAGAACAACAAGAATATGGCCTTCAAACTCAAGTCCA
AGTCTTGTCATGACCTATCGGTACTTTAAGAACTTTGGACTCTGCCAGAGCTTTTGGCATTTTGTGGACATTATCGAAC
TATGTTGTGGGAAATAATCTATATTAGATTGGGCTATGAAAATGACTTAGATTCACAGTTGTGATCGTGATGATACGTG
CTGACATAAGAACAGCACAGTGCATGGAAATATCTCTCTTTCATTTTCTTTGTTTTAGTTTTGTAAGAAAAGTATAAAC
CAGAATGATCCGAAATTGTGCTGGGAAAGCATTCCGGAATATACCTATTTCTTCTCCACTCACCTTTGGATAATAGCTT
AAGAACCTCAAACTGTCATGACTTGGGAAGTGAATACTACACTCTTTACTCTTTCTCACTGTAATTACTCTTTTATTTT
TATTTTCTTTTCTGAAAATTGTGTAAAGAATTGAGGAACTGACCAGGCGTTGATCCCTCGCCAATTGGCTGGTCAGGCT
TGAGCACCCACAGCTGAAAATATGCATGTTGTAGAATAGCCACCAGAACACTTCTTCTTATTATTTCGAGGATTGGTTC
CAATGAGTTTACACATCTCTTACTTTGAAAATATTTACACGGAAAAATCCCTATAAGTCAAATATTTTTTTCCTCTCAT
ATTTCTATGTTCAGGGGCCTGTTTAAAACTCATAGTCAAAATAAGATTAAAGCACCAGGCTGTAT
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.14455

Mouse

EmageMGI:99844
EurexpressMGI:99844
MGI GXDMGI:99844

Frog

Xenbase483369

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-060825-251
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona