|
MIR103A1 microRNA 103a-1Gene | Official Symbol | MIR103A1 | Official Full Name | microRNA 103a-1 | BirdBase ID | BB-GG14330 | CGNC ID | 59132 | also known as | MIR103-1, MIRN103-1, gga-mir-103-1, mir-103-1, microRNA 103-1|microRNA mir-103-1, mir-103 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | Entrez Gene | 777840 | Ensembl Gene | | KEGG | |
|
GEISHA Id | gga-miR-103 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show AGCAGCATTGTACAGGGCTATGA
| Comments | Sequences of mature forms of mir-103-1 and mir-103-2 are identical. |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 19-24 |
 | stage 24 |  | stage 24 | | Hindbrain
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|