| |
MIR103A1
microRNA 103a-1| Gene | | Official Symbol | MIR103A1 | | Official Full Name | microRNA 103a-1 | | CGNC ID | 59132 | | also known as | MIR103-1, MIRN103-1, gga-mir-103-1, mir-103-1, microRNA 103-1|microRNA mir-103-1, mir-103 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777840 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-103 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show AGCAGCATTGTACAGGGCTATGA
| | Comments | Sequences of mature forms of mir-103-1 and mir-103-2 are identical. |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 19-24 |
 | | stage 24 |
 | | stage 24 |
| Hindbrain
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
