|
MIR107 microRNA 107Gene | Official Symbol | MIR107 | Official Full Name | microRNA 107 | BirdBase ID | BB-GG14333 | CGNC ID | 59117 | also known as | MIRN107, gga-mir-107, mir-107, microRNA mir-107, mir-107 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | Entrez Gene | 777819 | Ensembl Gene | | KEGG | |
|
GEISHA Id | gga-miR-107 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show AGCAGCATTGTACAGGGCTATCA
| Comments | contained in an intron of EntrezGene: PANK1, 423792, pantothenate kinase 1-like protein ENSGALG00000006431 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|