|
MIR146A microRNA 146aGene | Official Symbol | MIR146A | Official Full Name | microRNA 146a | CGNC ID | 59125 | also known as | MIRN146A, gga-mir-146a, mir-146a, microRNA mir-146a, mir-146 | gene type | miscRNA |
| Genomic Map | | Sequence Information | Genomic | | RNA | | Polypeptide | NC_006100 | Sequence Clusters/ESTs | Unigene |
| Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-146 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGAGAACTGAATTCCATGGGTT
| Comments | stages 15 and above, ubiquitous |
MouseFrogFruit FlyZebra FinchZebrafish
|
|