| |
MIR148A
microRNA 148a| Gene | | Official Symbol | MIR148A | | Official Full Name | microRNA 148a | | CGNC ID | | | also known as | MIRN148A, gga-mir-148a, mir-148a, microRNA mir-148a, mir-148a | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-148a | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TCAGTGCACTACAGAACTTTGT
| | Comments | no expression detected |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | X-XIV | | Unlabeled
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
