|
MIR16-1 microRNA 16-1Gene | Official Symbol | MIR16-1 | Official Full Name | microRNA 16-1 | CGNC ID | 59221 | also known as | MIRN16-1, gga-mir-16-1, mir-16-1, microRNA mir-16-1, mir-16 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-16 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TAGCAGCACGTAAATATTGGTG
| Comments | widespread expression (not heart) detected stages 3-24; mir-16-2 contained in gene for SMC4 structural maintenance of chromosomes 4-like 1 |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 19 |
 | stage 19 | | Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|