|
MIR16-2 microRNA 16-2Gene | Official Symbol | MIR16-2 | Official Full Name | microRNA 16-2 | CGNC ID | | also known as | MIRN16-2, gga-mir-16-2, mir-16-2, microRNA mir-16-2, mir-16 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-16 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TAGCAGCACGTAAATATTGGTG
| Comments | widespread expression (not heart) detected stages 3-24; mir-16-2 contained in gene for SMC4 structural maintenance of chromosomes 4-like 1 |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 19 |
![](http://geisha.arizona.edu/geisha/photos/thumbs/16.6.002.jpg) | stage 19 | | Widespread Expression
|
| Data from NCBI Unigene EST Profile Unigene ID: Gga.13490 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|