| |
MIR18A
microRNA mir-18a| Gene Summary | Expression  | Other Species Expression |
| Gene | | Official Symbol | MIR18A | | Official Full Name | microRNA mir-18a | | BirdBase ID | BB-GG14378 | | CGNC ID | | | also known as | MIRN18A, gga-mir-18a, , mir-18a | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | Genbank | | RNA | | | Polypeptide | | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Zebrafish | | | | | | Xenopus | | | | | | Mouse | | | | | | Human | | | | | | Fruit Fly | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-18a | Data Source | GEISHA ISH Analysis | | Probe Sequence | show TAAGGTGCATCTAGTGCAGATA
| | Comments | 18a and b differ by 1 base; polycistronic with mir-92, -19b, -20a, -19a and 17 |
MouseFrogFruit FlyZebrafish |
|
