|
MIR196B microRNA 196bGene | Official Symbol | MIR196B | Official Full Name | microRNA 196b | BirdBase ID | BB-GG14384 | CGNC ID | 60553 | also known as | MIR196-2, MIRN196-2, MIRN196A2, gga-mir-196-2, mir-196-2, mir-196-4, mir-196-5, microRNA 196-2|microRNA mir-196-2, mir-196 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-196 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TAGGTAGTTTCATGTTGTTGG
| Comments | stages 4-12 were negitive, stages 15-25 had potential low level surface ectoderm label (ambiguous compared to background); |
no images
| Data from NCBI Unigene EST Profile Unigene ID: Gga.29885 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|