| |
MIR196B
microRNA 196b| Gene | | Official Symbol | MIR196B | | Official Full Name | microRNA 196b | | CGNC ID | 60553 | | also known as | MIR196-2, MIRN196-2, MIRN196A2, gga-mir-196-2, mir-196-2, mir-196-4, mir-196-5, microRNA 196-2|microRNA mir-196-2, mir-196 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-196 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TAGGTAGTTTCATGTTGTTGG
| | Comments | stages 4-12 were negitive, stages 15-25 had potential low level surface ectoderm label (ambiguous compared to background); |
no images | | Data from NCBI Unigene EST Profile
Unigene ID: Gga.29885 |
MouseFrogFruit FlyZebra FinchZebrafish |
|
