| |
MIR196A2
microRNA 196a-2| Gene | | Official Symbol | MIR196A2 | | Official Full Name | microRNA 196a-2 | | CGNC ID | 59171 | | also known as | MIR196-3, MIRN196-3, gga-mir-196-3, microRNA 196-3|microRNA mir-196-3, mir-196 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777886 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-196 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TAGGTAGTTTCATGTTGTTGG
| | Comments | stages 4-12 were negitive, stages 15-25 had potential low level surface ectoderm label (ambiguous compared to background); |
no images MouseFrogFruit FlyZebra FinchZebrafish |
|
