|
MIR199B1 microRNA 199b-1Gene | Official Symbol | MIR199B1 | Official Full Name | microRNA 199b-1 | CGNC ID | | also known as | MIR199-1, MIRN199-1, gga-mir-199-1, gga-mir-199b, mir-199-1, microRNA 199-1|microRNA mir-199-1, mir-199a | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-199a | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show CCCAGTGTTCAGACTACCTGTTC
| Comments | mir-199a-1 located in an intron of novel protein coding gene ENSGALG00000023785; mir-199a-2 located in an intron of MYOC ENSGALG00000021074. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|