|
MIR199A2 microRNA 199a-2Gene | Official Symbol | MIR199A2 | Official Full Name | microRNA 199a-2 | BirdBase ID | BB-GG14387 | CGNC ID | | also known as | MIR199-2, MIRN199-2, gga-mir-199-2, mir-199-2, microRNA 199-2|microRNA mir-199-2, mir-199 | gene type | miscRNA |
| Genomic Map | | Sequence Information | Genomic | Genbank | RNA | | Polypeptide | | Sequence Clusters/ESTs | Unigene |
| Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-199a | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show CCCAGTGTTCAGACTACCTGTTC
| Comments | mir-199a-1 located in an intron of novel protein coding gene ENSGALG00000023785; mir-199a-2 located in an intron of MYOC ENSGALG00000021074. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|