| |
MIR222
microRNA 222| Gene | | Official Symbol | MIR222 | | Official Full Name | microRNA 222 | | CGNC ID | 59213 | | also known as | MIR222-1, MIR222A, MIRN222A, gga-mir-222, gga-mir-222-1, gga-mir-222a, gga-mir-222b, mir-222a, microRNA 222A|microRNA mir-222|microRNA mir-222-1|microRNA mir-222a | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006088 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-222a | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show AGCTACATCTGGCTACTGGGTCTC
| | Comments | no specific expression detected, ambiguous; there are 2 mir-222a genes near each other, and near mir-221 in the chick genome |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 13-15 |
 | | stage 15 |
| Unlabeled
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
