| |
MIR23B
microRNA 23b| Gene | | Official Symbol | MIR23B | | Official Full Name | microRNA 23b | | CGNC ID | 59164 | | also known as | MIRN23B, gga-mir-23b, mir-23b, microRNA mir-23b, mir-23b | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006127 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-23b | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show ATCACATTGCCAGGGATTACC
| | Comments | no specific label detected; found in gene Q5ZK89_CHICK Aminopeptidase O along with mir-24 and -27b |
no images MouseFrogFruit FlyZebra FinchZebrafish |
|
