|
MIR24-2 microRNA 24-2Gene | Official Symbol | MIR24-2 | Official Full Name | microRNA 24-2 | CGNC ID | | also known as | MIR24, MIR3074, MIRN24, gga-mir-24, mir-24, microRNA 24|microRNA 3074|microRNA mir-24, mir-24 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-24 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGGCTCAGTTCAGCAGGAACAG
| Comments | no specific expression detected; contained in Q5ZK89_CHICK Aminopeptidase O (C0orf3) along with mir-23b and -27b |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 13-14 |
 | stage 14 | | Unlabeled Embryonic
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|