| |
MIR24-2
microRNA 24-2| Gene | | Official Symbol | MIR24-2 | | Official Full Name | microRNA 24-2 | | CGNC ID | | | also known as | MIR24, MIR3074, MIRN24, gga-mir-24, mir-24, microRNA 24|microRNA 3074|microRNA mir-24, mir-24 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-24 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGGCTCAGTTCAGCAGGAACAG
| | Comments | no specific expression detected; contained in Q5ZK89_CHICK Aminopeptidase O (C0orf3) along with mir-23b and -27b |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 13-14 |
 | | stage 14 |
| Unlabeled Embryonic
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
