| |
MIR29B2
microRNA 29b-2| Gene | | Official Symbol | MIR29B2 | | Official Full Name | microRNA 29b-2 | | CGNC ID | | | also known as | MIR29B-2, MIRN29B-2, gga-mir-29b-2, mir-29b-2, microRNA mir-29b-2, mir-29b | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | Genbank | | RNA | | | Polypeptide | | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-29b | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TAGCACCATTTGAAATCAGTGTT
| | Comments | no expression detected stages 4-24 |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 1 |
 | | stage 1 |
| Unlabeled
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
