| |
MIR30C1
microRNA 30c-1| Gene | | Official Symbol | MIR30C1 | | Official Full Name | microRNA 30c-1 | | CGNC ID | 59147 | | also known as | MIR30C-1, MIRN30C-1, gga-mir-30c-1, mir-30c-1, microRNA mir-30c-1, mir-30c | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777861 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-30c | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGTAAACATCCTACACTCTCAGC
| | Comments | no expression detected stages 4-25.
This miR (30c-1) contained in the intron of ENSGALG00000003189 (NFYC) with mir-30e |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 13-18 |
 | | stage 17 |
| | | 19-21 |  | | stage 21 |
| Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
