| |
MIR30C2
microRNA 30c-2| Gene | | Official Symbol | MIR30C2 | | Official Full Name | microRNA 30c-2 | | CGNC ID | | | also known as | MIR30C-2, MIRN30C-2, gga-mir-30c-2, mir-30c-2, microRNA mir-30c-2, mir-30c-2 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | Genbank | | RNA | | | Polypeptide | | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-30c | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGTAAACATCCTACACTCTCAGC
| | Comments | no expression detected stages 4-25.
This miR (30c-1) contained in the intron of ENSGALG00000003189 (NFYC) with mir-30e |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 13-18 |
 | | stage 17 |
| | | 19-21 |  | | stage 21 |
| Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
