| |
MIR32
microRNA 32| Gene | | Official Symbol | MIR32 | | Official Full Name | microRNA 32 | | CGNC ID | 59091 | | also known as | MIRN32, gga-mir-32, mir-32, microRNA mir-32, mir-32 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006090 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777798 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-32 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TATTGCACATTACTAAGTTGC
| | Comments | no expression detected
this miR located on the sense strand within the gene for Protein C9orf5 (Protein CG-2). ENSGALG00000013138 |
no images MouseFrogFruit FlyZebra FinchZebrafish |
|
