|
MIR7-1 microRNA 7-1Gene | Official Symbol | MIR7-1 | Official Full Name | microRNA 7-1 | CGNC ID | 59162 | also known as | MIRN7-1, gga-mir-7-1, mir-7-1, microRNA mir-7-1, mir-7 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | Entrez Gene | 777876 | Ensembl Gene | | KEGG | |
|
GEISHA Id | gga-miR-7 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGGAAGACTAGTGATTTTGTTG
| Comments | one copy of this miR found in an intron of
ENSGALG00000012591 |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 25-30 |
 | stage 25 |  | stage 30 | | Atria Unlabeled
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|