| |
MIRLET7C
microRNA let-7c| Gene | | Official Symbol | MIRLET7C | | Official Full Name | microRNA let-7c | | CGNC ID | 59209 | | also known as | MIRNLET7C, gga-let-7c, let-7c, microRNA 7C, let-7c | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | Genomic | | | RNA | | | Polypeptide | NC_006088 | | Sequence Clusters/ESTs | Unigene |
| | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777928 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-let-7c | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGAGGTAGTAGGTTGTATGGTT
| | Comments | found in gene ENSGALG00000019198 along with mir-99a and mir-125b; weak or ambiguous expression |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 19-24 |
 | | stage 24 |
| Somites
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
