| |
MIRLET7I
microRNA let-7i| Gene | | Official Symbol | MIRLET7I | | Official Full Name | microRNA let-7i | | CGNC ID | | | also known as | MIRNLET7I, gga-let-7i, let-7i, microRNA 7I, let-7i | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | In Situ Hybridization | GEISHA | | EST Profile | |
| | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-let-7i | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGAGGTAGTAGTTTGTGCTGT
| | Comments | no label detected before stage 25 |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 25 |
 | | stage 25 |
 | | stage 25 |
| Telencephalon
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
