|
MIRLET7I microRNA let-7iGene | Official Symbol | MIRLET7I | Official Full Name | microRNA let-7i | CGNC ID | | also known as | MIRNLET7I, gga-let-7i, let-7i, microRNA 7I, let-7i | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-let-7i | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGAGGTAGTAGTTTGTGCTGT
| Comments | no label detected before stage 25 |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 25 |
 | stage 25 |  | stage 25 | | Telencephalon
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|