GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SMARCA2
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Gene
Official SymbolSMARCA2
Official Full NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
CGNC ID7728
also known asBRM, probable global transcription activator SNF2L2
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205139
PolypeptideNP_990470
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4606
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human6595ENSG00000080503MIM:600014
Mouse67155ENSMUSG00000024921All phenotypic alleles (1):Targeted, knock-out(1) MGI:99603
Xenopus734002, 4033801013842
Zebrafish334032ENSDARG00000008904ZDB-GENE-030131-5964ZFIN:ZDB-GENE-030131-5964
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene396040
Ensembl GeneENSGALG00000010164
KEGGgga:396040
GEISHA IdSMARCA2.Olivera-Martinez.2014Data SourcePublication
Complete cDNA Template Probeshow
ATGTCCACGCCCACAGACCCTGGCGCCATGCCTCATCCTGGTCCTTCCCCCGGACCAGGACCTTCACCTGGACCGATTC
TAGGACCTAGTCCAGGACCAGGGCCATCTCCTGGCTCAGTTCACAGCATGATGGGGCCAAGTCCTGGTCCACCCAGTGT
CCCTCATCAGATGCCAGCAATGGGGGCTACTGATTATCCACAGGAAGGCATGCACCAAATGCATAAGTCCATTGATGGC
TTGCATGAGAAAGGAATGGTTGAAGACGTTCATTGTGGCTCCATGAAGACTATGCGACCTCCTCACCCTGGGATGGGCC
CACCTCAGAGTCCAATGGACCAGCACAGCCAAGGTTATATGTCTCCACACCCGTCTCCACTAGGAGCACCAGAGCATGT
GTCCAGTCCAATGTCTGGAGGAGGTCCAACTCCACCCCAGATGACTCCCAGCCAACCGGGACCTATTATACCTGGGGAC
CCACAAGTTATGAATCAACCCAACAGAGGTCCTTCCCCTTTCAGCCCTGTACAGCTGCACCAACTTCGGGCTCAGATTC
TAGCATACAAAATGTTAGCTAGAGGTCAGCCTTTGCCAGAAAATCTCCAGCTTGCTGTTCAGGGGAAACGGACCCTTCC
TGGTATTCAACAGCAGGAGCCTCCCAGTGCCTTCAACAGACAGTCTGGTATTGGGATGCATCCAATGAGTGGTGCTGCA
ACTGGACCAGGGCCTGCTGCAGGAATACCTGGACATACAGCTGCCATTACCTCTAAAACTTGGAATGAAGGCCAAACCC
CAGATATGAGTGTCTCCAGTGCACCGCAAAAACTTCCTGCACCATCTCCAAGTGGGAGGCCTTCTCCTGCCCCTACAGC
TGCCCAGCCTGCTGCTGCTATGCCTGGGCCTTCTGTACCACAGCCACCACCTGGACAGCCTTCCCCCATTGTTCAGCTG
CAGCAAAAGCAGAATCGCATCAGCCCTATTCAAAAGCCACAAGGATTAGACCCCGTTGAAATTCTTCAAGAACGTGAAT
ATAGGCTTCAAGCACGAATTGCTCACAGAATCCAGGAACTGGAGAACTTGCCAGGTTCTCTGCCCCCTGATCTGCGAAC
CAAAGCGACGGTGGAGTTGAAGGCACTTAGGTTACTGAATTTCCAGCGCCAGTTGAGACAAGAGGTAGTAGCCTGTATG
CGTCGTGATACAACCCTGGAGACGGCACTGAACTCCAAGGCCTATAAACGAAGCAAGCGCCAGACTTTGAGGGAGGCAC
GTATGACTGAAAAGCTTGAGAAACAGCAGAAGATAGAACAGGAGAGGAAGCGTAGACAGAAGCATCAGGAGTACCTGAA
TAGCATATTGCAGCATGCTAAAGACTTCAAGGAGTACCATCGGTCAGTGGCTGGCAAGATTCAGAAACTTTCCAAAGCT
GTGGCAACTTGGCATGCCAACACTGAACGTGAGCAGAAGAAAGAAACTGAGAGAATTGAGAAAGAAAGAATGAGGAGAC
TAATGGCTGAAGATGAAGAAGGCTACCGTAAGCTGATTGACCAAAAGAAAGATAGACGCCTGGCCTATCTGTTGCAGCA
GACAGACGAGTACGTTGCTAACTTGACTAATCTGGTATGGGAACATAAACAGGCACAAGCAGCCAAAGAAAAGAAGAAG
AGGAGGAGAAGAAAGAAGAAGGCTGAAGAGAATGCAGAAGGCATGGCATCTGGTCTTGGTCCTGATGGAGAGCCCATAG
ATGAGAGCAGCCAGATGAGTGACCTTCCTGTCAAAGTGACTCACACTGAAACAGGCAAAGTTCTTCTTGGTCCAGAGGC
ACCAAAAGCAAGTCAGCTAGATGCTTGGCTGGAAATGAACCCTGGCTATGAAGTTGCTCCCAGGTCAGACAGTGAAGAT
GAAAGTGGTTCTGAATATGAGGAGGAGGATGATGAAGAAGAATCAAGCAGATTAGAAGCAGATGAGAAGATACTCCTGG
ATCCTAACAGTGAAGAAGTTTCTGAGAAAGATGCTAAGCAAATAATTGAGACAGCCAAACAAGATGTGGATGATGAATA
CAGTATGCAATATAGTGCTAGAGGGTCTCAGTCCTACTACACAGTTGCACATGCAATCACAGAAAGGGTGGAAAAGCAG
TCTTCTCTTCTAATTAATGGCACACTAAAACATTATCAGCTTCAGGGACTGGAATGGATGGTTTCACTCTATAATAACA
ATCTGAATGGGATTTTAGCTGATGAAATGGGTCTGGGAAAGACAATTCAGACTATCGCACTTATCACTTACTTGATGGA
GCACAAAAGGCTCAATGGCCCCTATCTCATCATTGTTCCCCTTTCGACATTATCCAACTGGACATACGAATTTGACAAA
TGGGCTCCTTCTGTGGTGAAGATATCTTACAAGGGTACACCTGCAATGCGCCGCTCACTTGTTCCTCAGCTTCGAAGTG
GAAAATTTAATGTTCTTTTGACTACTTATGAGTACATAATAAAGGACAAACATATCCTTGCTAAGATTCGATGGAAATA
CATGATAGTAGATGAAGGTCATCGAATGAAGAATCATCACTGCAAACTGACTCAGGTCTTGAACACTCACTATGTGGCC
CCTAGGCGAATTCTACTGACTGGGACACCATTGCAGAATAAATTGCCTGAACTGTGGGCTCTTCTCAATTTCCTTCTCC
CAACCATCTTCAAGAGCTGTAGCACCTTTGAACAGTGGTTCAATGCTCCATTTGCCATGACAGGAGAAAGGGTGGACTT
AAATGAAGAAGAAACTATTCTGATCATCCGTCGTCTCCATAAAGTACTCCGACCCTTCTTGCTGAGAAGACTGAAGAAG
GAAGTAGAGTCTCAACTGCCAGAAAAGGTAGAATATGTGATCAAATGTGATATGTCTGCTCTCCAGAAGATCCTATACC
GACACATGCAAGCCAAGGGAATCCTTCTTACAGATGGTTCTGAGAAAGACAAGAAGGGAAAAGGTGGCGCAAAGACTCT
TATGAACACCATCATGCAACTGAGAAAGATTTGCAATCATCCATATATGTTTCAGCACATTGAGGAATCCTTTGCTGAA
CATTTAGGCTACTCAAATGGTGTCATCAATGGAGCTGAACTTTATCGGGCCTCCGGAAAGTTTGAGCTACTTGATCGTA
TTCTACCAAAGTTACGAGCTACAAACCATCGTGTGCTTCTTTTCTGTCAAATGACATCACTCATGACCATTATGGAAGA
CTACTTTGCCTTTCGAAATTTCCTGTACTTGCGTCTTGATGGCACAACAAAATCAGAAGACAGAGCTGCTCTCTTGAAG
AAGTTCAACGAGCCTGGGTCACAATACTTTATCTTTTTGCTGAGTACAAGGGCTGGAGGGCTAGGCTTAAATCTCCAGG
CTGCTGATACTGTTATAATCTTTGATAGTGACTGGAATCCTCACCAGGACTTGCAGGCACAAGATAGAGCTCACCGAAT
TGGCCAGCAGAATGAAGTTCGAGTTTTGCGACTGTGCACCGTGAACAGCGTGGAAGAGAAGATTCTTGCTGCTGCAAAG
TATAAGTTGAATGTAGATCAAAAAGTTATTCAGGCTGGAATGTTTGATCAAAAGTCTTCAAGTCATGAAAGGAGGGCTT
TTCTACAGGCTATACTGGAGCATGAGGAAGAAAATGAGGAAGAAGATGAAGTTCCTGATGATGAGACTCTGAATCAGAT
GATTGCTCGACGTGAAGAGGAATTTGATCTCTTTATGCGTATGGACATGGACCGTCGTAGAGAAGATGCCAGAAACCCC
AAGCGCAAGCCCCGCTTGATGGAGGAGGATGAGTTGCCATCGTGGATTATTAAGGATGATGCTGAAGTTGAAAGGCTCA
CGTGTGAAGAAGAGGAAGAAAAGATATTTGGAAGAGGATCCCGTCAACGTAGGGATGTGGACTACAGTGATGCTCTCAC
AGAGAAACAGTGGCTGCGGGCAATCGAAGACGGCAATTTGGAAGAAATGGAAGAGGAAGTCCGGCTTAAAAAGCGGAAG
AGACGAAGAAATGTGGATAAGGATTCTGGGAAGGAGGATGGAGAGAAAGCAAAGAAAAGAAGAGGCAGACCTCCTGCAG
AGAAATTATCACCTAACCCACCCAAACTGACGAAACAAATGAATGCCATCATTGATACAGTGATAAACTACAAAGACAG
TTCTGGGCGGCAGCTAAGTGAAGTCTTCATTCAGCTCCCATCGAGGAAAGAACTACCAGAGTATTATGAATTGATTAGG
AAACCAGTGGACTTCAAAAAAATTAAGGAAAGAATTCGCAACCATAAATATCGGAGTCTTGGGGATCTGGAGAAGGATG
TCATGTTGCTGTGTCATAATGCTCAGACATTCAATCTGGAGGGATCACAGATCTATGAGGATTCTATTGTTCTTCAGTC
TGTGTTCAAAAGTGCACGACAGAAGATTGCCAAAGAAGAAGAAAGTGAGGACGAAAGCAATGATGATGAAGATGAGGAT
GATGAAGAGGAGTCAGAGTCAGAATCAAAATCTGTGAAAGTCAAAATCAAGCTGAATAAGAAGGATGAAAAAAGTCGGG
AGAAAGGAAAAGGCAAGAAGAGGCAAAGCCGAGCAAAAGCCAAACCTGTTGTGAGTGATGATGATAGTGATGAGGATCA
AGATGAAAATGACCAGTCGGAAGCAAGCGGAAGTGATGATGAGTGA
CitationIsabel Olivera-Martinez, Nick Schurch, Roman A Li, Junfang Song, Pamela A Halley, Raman M Das, Dave W Burt, Geoffrey J Barton, Kate G Storey. Major transcriptome re-organisation and abrupt changes in signalling, cell cycle and chromatin regulation at neural differentiation in vivo. Development 2014 Aug;141(16):3266-76. Epub 2014 Jul 25. DOI: 10.1242/dev.112623.
CopyrightCopyright © 2014. Published by The Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205139.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Neural Plate/Tube
 
all
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4606

Mouse

EmageMGI:99603
EurexpressMGI:99603
MGI GXDMGI:99603

Frog

Xenbase1013842

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-5964
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona