GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LMO1
LIM domain only 1 (rhombotin 1)

Gene
Official SymbolLMO1
Official Full NameLIM domain only 1 (rhombotin 1)
CGNC ID64309
also known asLMO-1, rhombotin-1, rhombotin-1|LIM domain only protein 1|T-cell translocation gene 1|T-cell translocation protein 1|cysteine-rich protein TTG-1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003641298
PolypeptideXP_003641346
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100858792
Ensembl Gene
KEGGgga:100858792
GEISHA IdChEST566o24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCTTGACGTGTCGTGGCATCGTGTCAGGGAGGTAACGTCGTTCCGTGTGTTGGAAGTGACGTGGTGTAACCTGGCCGAT
ACAGCACGACTCGATATTAGAAGCTACAGCCTCGCCGTTTGGTCCCGAAATAAGAGCAGAGGGGAGAGAGCTGGGGAAA
GAACGGGAAGGTGGAGAGCAAGAAAAACCTACCCCGAGGTGTGCCGATGTTATCCGTACAACCCAAGGGGAAGCAGAAG
GGCTGTGCTGGCTGCAACCGGAAGATCAAGGACCGGTACCTGCTGAAGGCCCTGGATAAGTACTGGCACGAAGACTGCC
TGAAGTGCGCCTGCTGCGACTGTCGTCTTGGAGAGGTTGGATCAACCCTTTACACAAAAGCAAATCTCATCCTTTGCCG
CAGAGATTACCTGAGGCTCTTCGGTACCACCGGGAATTGCGCTGCCTGCAGTAAGCTGATCCCTGCCTTTGAGATGGTG
ATGAGGGCCAGAGATAATGTTTACCATTTGGACTGCTTCGCCTGTCAGCTCTGCAACCAGCGGTTCTGCGTGGGGGACA
AGTTTTTCCTGAAGAACAACATGATCTTGTGTCAGATGGACTATGAGGAAGGGCAGCTGAACGGGAGCTTCGAGTCCCA
GGTTCAATAGCGATCCCTGCTTCGCTGGAGCACTGTGGATGGGCGCCCGGCCGCGCCAGCAGCCAGCCGTCTGTCAGCT
TGCCTGCAATATTTTTTTAATTCTGGTCCAGAGAGGACTATATACATTGTAGTACTTTCGCCCCACCCCCCCAACACGG
AGCAGTTACAATTTTAGATGTACAGTTGTGCCTGCTTAGCTGAGCACTGCATTGCCTGTATGTTTGTGAGTTTCAGGGT
CTGGGGGAGGGCTCTGTACAGTCTGTTTTCTGTATAT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
Neural Plate/Tube
 
7-12
stage 8
stage 9
stage 10
Forebrain
Hindbrain
Midbrain
Neural Plate/Tube
Spinal Cord
 
13-18
stage 15
stage 16
Forebrain
Hindbrain
 
19-21
stage 21
Forebrain
Limb Buds
Splanchnic Mesoderm
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona