| |
LOC100858841 cytochrome P450 26B1-like| Gene | | Official Symbol | LOC100858841 | | Official Full Name | cytochrome P450 26B1-like | | CGNC ID | 64266 | | also known as | | | gene type | protein-coding |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | Cyp26B1.Renijntjes.2003 | Data Source | Publication | | Complete cDNA Template Probe | show TCGGCACTGGCTACCCTCGCGGCGTGCTTGGTGTCACTGACTTTGCTGCTGGCCGTGTCCCAACAGCTGTGGCAGCTCC GCTGGGCTGCCACCCGCGACAAAACCTGCAAGCTACCAATCCCTAAAGGCTCTATGGGATTCCCTTTAATCGGAGAAAC CTTCCACTGGCTCCTGCAGGGTTCGTGCTTCCAGTCTTCGCGACGGGAGAAGTACGGCAACGTGTTCAAGACGCACCTT TTGGGGCGGCCGCTGGTGAGGGTGACGGGAGCGGAGAACGTGCGGAAGATTCTGATGGGGGAACACCACCTGGTGAGCA CCGAATGGCCGCGCAGCACCCGCATGCTGCTGGGACCCAACACCGTGGCCAACTCCATCGGGGACATCCA | | Citation | Reijntjes S, Gale E, Maden M. Expression of the retinoic acid catabolising enzyme CYP26B1 in the chick embryo and its regulation by retinoic acid. Gene Expr Patterns. 2003 Oct;3(5):621-7. | | Copyright | Reprinted from Gene Expr Patterns, Volume number, Susan Reijntjes, Emily Gale, and Malcolm Maden, Expression of the retinoic acid catabolising enzyme CYP26B1 in the chick embryo and its regulation by retinoic acid, Pages 621-627, Copyright 2003, with permission from Elsevier.
Copyright © 2003 Elsevier B.V. All rights reserved. | | Comments | Primers designed from ChEST239e5:
forward 5′-TCGGCACTGGCTACCCTCGC-3′ and reverse 5′-TGGATGTCCCCGATGGAGTT-3′ to generate a 385 bp product. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|