GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

APOC3
apolipoprotein C3

Gene
Official SymbolAPOC3
Official Full Nameapolipoprotein C3
CGNC ID
also known asapolipoprotein C-III
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003642603
PolypeptideXP_003642651
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene100859721
Ensembl Gene
KEGGgga:100859721

Entry 1

GEISHA IdAPOC3.Anderson.2020Data SourceDirect Submission
Complete cDNA Template Probeshow
CAAGCACAGCGCGGCCAGCCATGAAGGTCTCCATCCTGCTCCTGCTCATCTGCACGGCCATCCTGGCGGTGGGAGCGCG
GGCCGAAGCTCCCGATAAGACAGAAGTGGTGGTGAAGAAGGTGCAGGAGTACGTCAAGCAAGCCACTGAGGCAGTCAAG
ACGGCCTTCACCACAGTGCATGAGTCAGAGGCAGCTCAGCAAGCCAGGAAATGGCTGTCAGACAACGCCGACCTGGTGA
AGCAGCAGCTGGCAAAGCTGAAGGAGCAGCTGGCCGAGCTCTGGAAGCTGACGCCGACCGCGTAGCCCGGCTGTGGGCT
GGTGGGGGCCGACTGGGTGCGGGTCCTGCCCCCCATCCCACACACAGCACCGTTTCCCTTTTGTCGTGGTTCTTGCAAT
AAAGTGGAGCTGGAAAAA
CommentsImages and probe sequence provided by Claire Anderson.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
Atria
Ectoderm
Endoderm
Foregut
Lateral Plate Mesoderm
Notochord
Outflow Tract
Somites
Splanchnic Mesoderm
Ventricles
Yolk Sack or Stalk
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
section 06; truncus arteriosis
section 51

Entry 2

GEISHA IdAPOC3.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
TAAAGCACAGCGCGGCCAGCCATGAAGGTCTCCATCCTGCTCCTGCTCATCTGCACGGCCATCCTGGCGGTGGGAGCGC
GGGCCGAAGCTCCCGATAAGACAGAAGTGGTGGTGAAGAAGGTGCAGGAGTACGTCAAGCAAGCCACTGAGGCAGTCAA
GACGGCCTTCACCACAGTGCATGAGTCAGAGGCAGCTCAGCAAGCCAGGAAATGGCTGTCAGACAACGCCGACCTGGTG
AAGCAGCAGCTGGCAAAGCTGAAGGAGCAGCTGGCCGAGCTCTGGAAGCTGACGCCGACCGCGTAGCCCGGCTGTGGGC
TGGTGGGGGCCGACTGGGTGCGGGTCCTGCCCCCCATCCCACACACAGCACCGTTTCCCTTTTGTCGTGGTTCTTGCAA
TAAAGTGGAGCTGGAAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Proepicardium
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona