GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ZNF469
zinc finger protein 469

Gene
Official SymbolZNF469
Official Full Namezinc finger protein 469
CGNC ID
also known aszinc finger protein 469
gene typeunknown
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNA
Polypeptide
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene101748749
Ensembl Gene
KEGG
GEISHA IdZFPM1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTAGTGGGTTGGCAGAGCAAGTCG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGCAAACATCTCAGCAGACAGGCTTTCcDNA Template Length807
Forward cDNA Template Probeshow
GGCCCCCGATTAGGTAACCTCCTTCCAGACGCCCCGATGTTCTGCTGCGGACATTGTCCATTTGGCTGTTTTCCACAGG
AAGGTTAGCATGTTGTCCTCCAAGTCAATTACCTCCTTCTCTTGGTCGATCCTCTCAGCATCTGACCTCAACACAACAC
TTTTAGATCCACGAGGAATATCTTCTCCACTCTTTGCCTTGTTGCCGTGACACATGTTCACTGTTAAGGCATCATCAAT
GGAGATGGTCTCGTATTCGCAAGAGGTCCTCCCTGGTGAGGCACAAGGAGCCGGTGTCGCTGACGTTGTGATGTTACTT
GTATGGTGAAGAGGACCATGGCACCTGCTGGATGGAGGTTTGCCTCACTGAAGGGCTAGGGTTTCTTGCTGCGCTTCCC
ATAAACCCACCTGCATTTCCTCCGGATGAACTGGTCCTCCCCGGTGAACATCTGGTAGAATGTGGAGTCTTCCTCCTCC
TTGTGCTCCCCCCGTTGTGGAAGCTCTGCCTTCACCACCTGCTTTTTGTCTATGCATGTAGGGCTGGCTGCTGGCATAG
GCTGCAGGGCATTATGTGAGAGGAACATCTGAGAGACTTCTGGATCGTACGTCTCCGGCCAGAGGCCCCCATGATAACG
AGAAGGAGGACGCTATTGAGTATTGATACAATTTGTGTTGCCTCTGGTTTGAAAACCATCTAGTGTCTCAGGGTCCCTC
TCTTCCCTGCTGGGGGCATTGTAATGATGCTCGTTGCCACCTTAAACAAAGAAATTTCCTTTTGCGAGGGCAAAAT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Unlabeled
Stages 3, 4 & 5.
7-12
stage 7
stage 8
stage 9
stage 11
Anterior Intestinal Portal
Head Mesenchyme
Headfold
Heart Tube
Neural Plate/Tube
Notochord
Somites
Unlabeled
Stage 7+ to 8-. Low level expression.
Stage 8+ to 9-.
Stages 6-7.
13-18
stage 13
stage 16
stage 17
Allantois
Ear/Otic Placode
Head Mesenchyme
Heart Tube
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Somatic Mesoderm
 
19-23
stage 22
stage 23
Allantois
Ear/Otic Placode
Eye
Somatic Mesoderm
Somites
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona