|
IRX3 iroquois homeobox 3Gene | Official Symbol | IRX3 | Official Full Name | iroquois homeobox 3 | BirdBase ID | BB-GG56532 | CGNC ID | | also known as | iroquois-class homeodomain protein IRX-3|iroquois homeobox protein 3|iroquois homologue-3 homeodomain | gene type | unknown |
| Genomic Map | | Sequence Information | Genomic | | RNA | | Polypeptide | | Sequence Clusters/ESTs | Unigene |
| Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | IRX3.Anderson.2021 | Data Source | Direct Submission | Complete cDNA Template Probe | show CTGNGTCCACTCAGATCAATAGGAAAAGTGCGAGAAGAAAGCAGCGCGCGGCGCGCAGCGCGGCCGCAGCCAGGCGGGA GCCGCGGCCTCCGAGCTCCGCTCCCGATGCGGCCCGGAGCCGGCGGCGGGCGCTGAGCGCTGAGCTGTGCCGGCGGCCC CGCGGCCAGCCCCGCCGCTCGCTGCCCTTTCTCTCCCTTCTTCCCTTCTGCCCCCCCCTCCCTACCCTTCNCCCCTCCC CNCCCCCCC | Comments | Images and probe sequence provided by Claire Anderson. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|