GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

BMP10
bone morphogenetic protein 10

Gene
Official SymbolBMP10
Official Full Namebone morphogenetic protein 10
CGNC ID60
also known asBMP-10, bone morphogenetic protein 10, Bone morphogenetic protein-10, BMP10
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001278046
PolypeptideNP_001264975
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.9509
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human27302ENSG00000163217MIM:608748
Mouse12154ENSMUSG00000030046All phenotypic alleles (6):Targeted, knock-out(1) Targeted, other(5) MGI:1338820
Xenopus100487047478874
Zebrafish562533ENSDARG00000061769ZDB-GENE-060526-211ZFIN:ZDB-GENE-060526-211
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395177
Ensembl GeneENSGALG00000000120
KEGGgga:395177

Entry 1

GEISHA IdBMP10.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATATGGTGGTATCAGAGTGTGGCTG
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGGGTGAGACTGGTTTTAGTTGGTGCcDNA Template Length1078
Complete cDNA Template Probeshow
TTTTTTAAAACTTGGGCCCCAATTAGGGGTCCAGATGTGCAGATAGAGCAGGGAAGACATGGCACAGGGGGAGTGCACA
AGGGGAAGTATTTAATGATTCAGTCTGTAAATTTGTACATTTCGGATTTCCTATTTAATAAGGTATTTAATGAGGCATG
TACAGATAATTGTATGTTTCCTGTCACGGGGAATGGGCAAGTCATATGACCGTAGGGAATGTATATTTTTGTTCCATTG
CTTGCTTCTTGCTATTCTGTTCAAATTATGTCTGTCTCTCTTCATACCTGAGCATAGAGCACATCACTGGATTGTTTGG
GTGGGCTCTTCATGCTAGAAGGAGCACATTCAAATTCACAGGAATAAAGGCATCTTTTTGTGCTTTGTAAATGGTGATT
GGCATCTGTAGGGATTTCCAGAGTGACTATAGCTATGGGCAATACGTGCCCAGATTGTTCAGTTGTGTGTAAAATCTTT
ATAAAGATCTTTACATACTCAGATATTTTGAAAATTTATCTCTGTAGCTCTTAAATCTCAACAAAAGGTTTAGAATGGT
ACCAGTTTACACCAGCTCAGAATCTGGTCCCCCCCAACCAGTCCAGTAAGCTACATGCCATACATCCACGTAACCCAAT
TCAGATGGCCGAATAGTATTGCATTTAGTCTGCATAGAAATAGACAGAAAAGGAACCCCCATTGTGCCAGCTAGATAGA
GAGGATCTTTCCTTTATGTATGTGCTGAAGTTGTCAATTCATAAAGGTACTGCCCCCCCTTACATGATATATGATGGAG
TCACATGCCATGTTTCCGCCACTCTTCTGCAACAAATCGCAGTGATAAGAAGGTGTCGGAGCTGAAAACAATAGACCCG
TCACTTTATTTATACTAAGCTGCAAAATTTGTCAGATTCTTGGGAAAGTGTAAGTGACCTGACTCTTTTAGCCTGTACC
AGAGCCTACTGTACTGTCCCTGCATCTGTTTTACACTTTTAAGGGAAAGTTATCTCACCTGGAAGTGATAAGGGCCTTT
GAAAGAATCCACCCAACACCTTCATGGGATACCTTACTTCCAAACCCGTCCCCCCTTGGGGGGTAATTTAAAAA
CommentsNo expression detected from stages 3 to 9.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
Unlabeled
 
7-12
stage 7
stage 9
stage 10
stage 10
Heart Tube
Unlabeled
Stage 9+ to 10-.
13-18
stage 14
stage 15
stage 16
Atria
Outflow Tract
Sinus Venosus
Ventricles
 
19-24
stage 19
stage 21
Anterior/Second Heart Field
Atria
Ventricles
 
25
stage 25
Atria
Ventricles
 

Entry 2

GEISHA IdBMP10.Kruithof.2006Data SourcePublication
Complete cDNA Template Probeshow
GAAATTGCCAACTTCCATGGACACCCTGGTGAGGAGGCTCTGCTCCAGATGCGTTCTAACATCATTTATGACTCTACTG
CTCGAATCCGAAGGAACGCAAAAGGCAACTACTGCAAAAAGACTCCACTCTACATAGATTTCAAGGAGATTGGCTGGGA
TTCCTGGATCATCGCTCCAGCAGGATATGAAGCTTATGAGTGCCATGGAGTATGCGCCTACCCCTTAACAGAGCACGTC
ACCCCAACAAAACATGCCATTGTCCAGACTTTGGTTCACTTGAAGAATCCCCAGAAAGCCTCCAAGGCCTGCTGCGTGC
CCACCAAACTCGATCCTATCTCAATTCTCTACATGGATGCAGGGGTGGTCACCTACAAGTTCAAATATGAAGGCATGGT
GGTATCAGAGTGTGGCTGCAGATAGTAGCAGGAAGACATGCACAGGGGAGTGCACAAGGGAAGTATTTAATGATTCAGT
CTGTAAATTTGTACATNTCGGATTTCCTATTAATAAGGTTATTTAATGAGGCATGTACAGATAACTGTATGTTTCCTGT
CACGGGGAATGGGCAAGTCATATGACCGTAGGGAATGTATA
CitationKruithof BP, van Wijk B, Somi S, Kruithof-de Julio M, Pérez Pomares JM, Weesie F, Wessels A, Moorman AF, van den Hoff MJ. BMP and FGF regulate the differentiation of multipotential pericardial mesoderm into the myocardial or epicardial lineage. Dev Biol. 2006 Jul 15;295(2):507-22. Epub 2006 Apr 3.
CopyrightCopyright © 2006 Elsevier B.V. All rights reserved.
CommentsAccording to the authors: The in situ hybridization procedure and the probes used were recently described (Somi et al., 2004a and Somi et al., 2004b). These sources indicated: Chicken cDNA (604156553F1), which is similar to human and mouse BMP10, was identified in the UMIST Est database (Boardman et al., [2002]) and obtained from the MRC geneservice (Cambridge, UK). This clone is shown as probe.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 16
stage 16
Splanchnic Mesoderm
peri-proepicardial mesoderm

Entry 3

GEISHA IdBMP10.Ishii.2010Data SourcePublication
Complete cDNA Template Probeshow
ATGGATTCCATAGTCCTCCAGCTGTGGGCTGGCCTCTGCCTCTTGGTTCACCTTGCCACTTGCAGTCCCATCCTGAGCT
TGGAGCACTCTTCCTTAGAGGAAGGCGAGCCTCTTTTCGATGAATTCCTGTCCGAGCAGGATGGTGTTGATTTCAACAC
ATTGCTTCAGAATATGAAGAACGAGTTCCTGAAGACGTTGAACCTCTCCGACATTCCTCTGCACGAGTCGGCCAAAGTG
GACCCACCAGAGTACATGTTAGAGCTGTACAACAAGTTTGCCACTGACAGGACATCTATGCCATCTGCAAATATCATTA
GGAGCTTCAAAAATGAAGACCTTGCTTCCCACCCTGTTGGCGTCATAGGAGTTCGGAAATACCCCCTTCTGTTCAATGT
CTCCATCCCTCATCATGAAGAAATCACCATGGCGGAGCTGAGACTCTACACCTTGGTGGAGAGGGACCAAATGCTTTAT
GAAGGGCTCGACCGAAAGGTCACCATTTTTGAAGTGCTGGAAAATGACCATATGGGGGTAGGAGAAGAAAGAAAGATCG
TGGCGCTGGCATCCAGACAGATCTATGGCACAAGCAGTGAGTGGGAGAGCTTCGAGGTGACCGAAGCCATCAGGCGTTG
GCGAAGGGCAGGGCTGACCACGCACCGGCTGGAGGTTCACATTGAGAGCAGAGAAGGGGAGGAGCAGAATGGAGAGGGG
AAACTCGATATCGACATCAACTCTGAGGCTAAGCACGTGCCCCTGTTGATTGTGTTCTCTGATGACCAAAGCAATGATC
AGAAAGAGGAGAAGCAAGAGCTGAACGAAATGATAGACCATGAGCAGCTCCTGGACTTGGAGAACCTGGAAGTTGGCAA
TTTCCATGGACACCCTGGTGAGGAGGCTCTGCTCCAGATGCGTTCTAACATCATTTATGACTCTACTGCTCGAATCCGA
AGGAACGCAAAAGGCAACTACTGCAAAAAGACTCCACTCTACATAGATTTCAAGGAGATTGGCTGGGATTCCTGGATCA
TCGCTCCAGCAGGATATGAAGCTTATGAGTGCCATGGAGTATGCGCCTACCCCTTAACAGAGCACGTCACCCCAACAAA
ACATGCCATTGTCCAGACTTTGGTTCACTTGAAGAATCCCCAGAAAGCCTCCAAGGCCTGCTGCGTGCCCACCAAACTC
GATCCTATCTCAATTCTCTACATGGATGCAGGGGTGGTCACCTACAAGTTCAAATATGAAGGCATGGTGGTATCAGAGT
GTGGCTGCAGATAGTAGCAGGGAAGACATGCACAGGGGAGTGCACAAGGGAAGTATTTAATGATTCAGTCTGTAAATTT
GTACATTTCGGATTTCCTATTTAATAAGGTTATTTAATGAGGCATGTACAGATAATTGTATGTTTCCTGTCACGGGGAA
TGGGCAAGTCATATGACCGTAGGGAATGTATATTTTGTTCCATTGCTTGCTTCTTGCTATTCTGTTCAAATTATGTCTG
TCTCTCTTCATACCTGAGCATAGAGCACATCACTGGATTGTTTGGGTGGGCTCTTCATGCTAGAAGGAGCACATTCAAA
TTCACAGGAATAAAGGCATCTTTTTGTGCTTTGTAAATGGTGATTGGCATCTGTAGGGATTTCCAGAGTGACTATAGCT
ATGGGCAATACGTGCCCAGATTGTTCAGTTGTGTGTAAAATCTTTATAAAGATCTTTACATACTCAGATATTTTGAAAA
TTTATCTCTGTAGCTCTTAAATCTCAACAAAAGGTTTAGAATGGTACCAGTTTACACCAGCTCAGAATCTGGTCCCCCC
CAACCAGTCCAGTAAGCTACATGCCATACATCCACGTAACCCAATTCAGATGGCCGAATAGTATTGCATTTAGTCTGCA
TAGAAATAGACAGAAAAGGAACCCCCATTGTGCCAGCTAGATAGAGAGGATCTTTCCTTTATGTATGTGCTGAAGTTGT
CAATTCATAAAGGTACTGCCCCCCCTTACATGATATATGATGGAGTCACATGCCATGTTTCCGCCACTCTTCTGCAACA
AATCGCAGTGATAAGAAGGTGTCGGAGCTGAGAAACAATAGACCCGTCACTTTATTTATACTAAGCTGCAAATTTGTCA
GATTCTTGGGAAAGTGTAAGTGACACTGACTCTTTTAGCCTGTACCAGAGCCTACTGTACTGTCCCTGCATCTGTTTTA
CACTTTTAAGGGAAAGTTATCTTCACTGGAAGTGATAAGGGCCTTTGAAAGAATCACTCTAACACTTCATGGGATTGAA
CACTTTATCATGCACCAACTAAAACCAGTCTCACCTATTTTCACACATACTCTTCTGTGCTTCCCATAATTTATTGATC
TATTTATTGACTGCCTGCCTCTGTAATATAATGTAGAATACAGAACGTTTTATTTTTGTGCTTGTATGTAACCCCACTT
GGATAAAACCTTGTACCGAC
CitationIshii Y, Garriock RJ, Navetta AM, Coughlin LE, Mikawa T.. BMP Signals Promote Proepicardial Protrusion Necessary for Recruitment of Coronary Vessel and Epicardial Progenitors to the Heart. Dev Cell. 2010 August 17; 19(2): 307–316.
CopyrightCopyright © 2010 Elsevier Inc. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #XM_417667.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
Heart
 

Entry 4

GEISHA IdBMP10.Anderson.2020Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
TCCAAGGCCTGCTGCGTGCCCACCAAACTCGATCCTATCTCAATTCTCTACATGGATGCAGGGGTGGTCACCTACAAGT
TCAAATATGAAGGCATGGTGGTATCAGAGTGTGGCTGCAGATAGTAGCAGGGAAGACATGCACAGGGGAGTGCACAAGG
GAAGTATTTAATGATTCAGTCTGTAAATTTGTACATTTCGGATTTCCTATTTAATAAGGTTATTTAATGAGGCATGTAC
AGATAATTGTATGTTTCCTGTCACGGGGAATGGGCAAGTCATATGACCGTAGGGAATGTATATTTTGTTCCATTGCTTG
CTTCTTGCTATTCTGTTCAAATTATGTCTGTCTCTCTTCATACCTGAGCATAGAGCACATCACTGGATTGTTTGGGTGG
GCTCTTCATGCTAGAAGGAGCACATTCAAATTCACAGGAATAAAGGCATCTTTTTGTGCTTTGTAAATGGTGATTGGCA
TCTGTAGGGATTTCCAGAGTGACTATAGCTATGGGCAATACGTGCCCAGATTGTTCAGTTGTGTGTAAAATCTTTATAA
AGATCTTTACATACTCAGATATTTGAAAATTTATCTCTGTAGCTCTTAAATCTCAACAAAAGGGTTAGAATGGTACCAG
TTTACACCAGCTCAGAATCTGGTCCCCCCAACAGTCCAGTAAGCTACATGCCATACATCCACGTAACCAATCAGATGGC
CGAATAGTATGCATTAGTCT
CommentsImages and probe sequence provided by Claire Anderson; Related article: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 12
stage 12
stage 12
Atria
Heart Tube
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Primitive Streak
Ventricles
section 44; epimyocardium
stage 12+

Entry 5

GEISHA IdBMP10.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
TCCAAGGCCTGCTGCGTGCCCACCAAACTCGATCCTATCTCAATTCTCTACATGGATGCAGGGGTGGTCACCTACAAGT
TCAAATATGAAGGCATGGTGGTATCAGAGTGTGGCTGCAGATAGTAGCAGGGAAGACATGCACAGGGGAGTGCACAAGG
GAAGTATTTAATGATTCAGTCTGTAAATTTGTACATTTCGGATTTCCTATTTAATAAGGTTATTTAATGAGGCATGTAC
AGATAATTGTATGTTTCCTGTCACGGGGAATGGGCAAGTCATATGACCGTAGGGAATGTATATTTTGTTCCATTGCTTG
CTTCTTGCTATTCTGTTCAAATTATGTCTGTCTCTCTTCATACCTGAGCATAGAGCACATCACTGGATTGTTTGGGTGG
GCTCTTCATGCTAGAAGGAGCACATTCAAATTCACAGGAATAAAGGCATCTTTTTGTGCTTTGTAAATGGTGATTGGCA
TCTGTAGGGATTTCCAGAGTGACTATAGCTATGGGCAATACGTGCCCAGATTGTTCAGTTGTGTGTAAAATCTTTATAA
AGATCTTTACATACTCAGATATTTGAAAATTTATCTCTGTAGCTCTTAAATCTCAACAAAAGGGTTAGAATGGTACCAG
TTTACACCAGCTCAGAATCTGGTCCCCCCAACAGTCCAGTAAGCTACATGCCATACATCCACGTAACCAATCAGATGGC
CGAATAGTATGCATTAGTCT
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.9509

Mouse

EmageMGI:1338820
EurexpressMGI:1338820
MGI GXDMGI:1338820

Frog

Xenbase478874

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-060526-211
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona