GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

JAG1
jagged 1

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolJAG1
Official Full Namejagged 1
CGNC ID6856
also known asprotein jagged-1|C-Serate-1 protein|jagged 1 (Alagille syndrome)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_415035
PolypeptideXP_415035
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.53615
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human182ENSG00000101384MIM:118450MIM:601920
Mouse16449ENSMUSG00000027276All phenotypic alleles (15):Chemically induced(5) Targeted, knock-out(3) Targeted, other(5) Gene trapped(2) MGI:1095416
Xenopus100486874, 399110485661
Zebrafish140423, 140421ENSDARG00000013168, ENSDARG00000030289ZDB-GENE-011128-4, ZDB-GENE-011128-2ZFIN:ZDB-GENE-011128-4, ZFIN:ZDB-GENE-011128-2
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene396043
Ensembl Gene
KEGGgga:396043

Entry 1

GEISHA IdJAG1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGGTGAAAGGTGAGGTGGCGTC
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGGGGCAGGAACACTGGTATTTATCGcDNA Template Length906
Forward cDNA Template Probeshow
TTTTTATCGGCAGAATACNGGGCAGTGTTGCTGCAGGTACACCATTCAACAGGGTGGGTGGGTTCCACAGTAGTTCAGG
TCTTTGTCACAGAGCTGACCACCCCAGTTGGTTTCACAGAGGCACTGCCATGGTTCAATGCAAGTGCCATGGACACATC
CCGGGTGTGGAATGCACTTATCACAGTACTGGCCTTGCCATCCATACTGACACCTGCACTCTCCTGGAACTGTGCAAGA
ACCATGCTTGGGGCTACATCCCTGACGACAAATAGCTTTGTTGCATTCTGGTCCCGTCCAGCCTTCCAAGCAGGTTTTG
TTGCCATTCTGGTCACAGGTATGGTGAGTGAAGAAGTCATCTCTCGGTCGACAAAACTTGTTGCATCCAAAGCCATAGT
AATGTTCTGCGCAAGTCACACGGATTTGATACTCAAAGTGGGCAGCTCCTGTGTTATGTTTCAACGTCTGCCACTGACG
GCTTGGATTGATCATGCCAGAGTGGGATGCCTTCTCAATTATGCGATCGGGATTAGTAGAGTTATCATTGTAATCCCAT
GCCTCAACAAGCAACGTGTAGGATCTCGGCCAGGCGAAGCTGAAAGGGATAACAATCCGGTTCTTTTCATTATTCCGGC
TGTACTTTAAATTGAAGGTATTCCCGCCGATGACAGGGGTGGATTTGGATCCGAAGCTGCAAGGGCCGCCAGCAGTGAC
CCGCGACTGGTACTCCTTCAGGCAAACTTTAAAGTAGGTGTCACACTCATCTCTGGTGCACTTTTTATCTCCGGGGTTT
CGAGTGCCGTCGCAGCAGTTCCCGTTCTGCAGCACGCCGTTCACATTCTGCACGGATAAGATCTCCAGCTCGAACTGTC
CCGATGCTGACGCCACCTCCCNTTTCCACCAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 6
Early Mesoderm
Lateral Plate Mesoderm
Primitive Streak
Low level expression.
7-12
stage 7
stage 9
stage 9
stage 10
stage 10
stage 10
stage 11
stage 11
stage 12
stage 12
Anterior/Second Heart Field
Ear/Otic Placode
Head Mesenchyme
Heart Tube
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Dorsal view.
Low level expression.
Ventral view.
13-18
stage 16
stage 17
Allantois
Anterior/Second Heart Field
Ear/Otic Placode
Eye
Heart Tube
Hindbrain
Midbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Pineal Gland
Spinal Cord
 
19-24
stage 21
stage 21
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 23
stage 23
stage 24
stage 24
Allantois
Anterior/Second Heart Field
Atria
Ear/Otic Placode
Eye
Forebrain
Hindbrain
Leg Mesenchyme
Mesonephros
Midbrain
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Pineal Gland
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
 
25
stage 25
stage 25
Allantois
Anterior/Second Heart Field
Atria
Ear/Otic Placode
Eye
Hindbrain
Leg Mesenchyme
Mesonephros
Midbrain
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Pineal Gland
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Wing Mesenchyme
 

Entry 2

GEISHA IdSERRATE1.Sanders.2002Data SourcePublication
Complete cDNA Template Probeshow
ATGCGTGCGGCCCGGCGGGCGGCGGCGCGCTCCCTCGTCCTCTTCCTGGCCCTGCTGGGGCTGCGGGCTCAGGTACGTT
CGGGGGGCGGGAGCGGTTCCCGCGGCGTTTGCTGGAGGGGGTCCCGGAGCTGCGGAGGCTGCGGGGCGGCTCGGCGGGA
GCGCGGGCGGTGGTGCCGGCTGTCCTGCGGGGAGGGCAGCGGTCCGTGTGGCGAGGCGAGGCGAGGCGAGGTTCCTCGA
GGATCCAACGCGGGGCTGCTCGTCCCGTCCCGTGTCGTCCCGTCCGCCGCCCCTCCGAGCTGCAGCGGCCGCTCTGCTG
CCGGCGCCGCGCTTCTTCTTCTTCTCTCTCGGAACGAGCAGGTGGCGTCAGCATCGGGACAGTTCGAGCTGGAGATCTT
ATCCGTGCAGAATGTGAACGGCGTGCTGCAGAACGGGAACTGCTGCGACGGCACTCGAAACCCCGGAGATAAAAAGTGC
ACCAGAGATGAGTGTGACACCTACTTTAAAGTTTGCCTGAAGGAGTACCAGTCGCGGGTCACTGCTGGCGGCCCTTGCA
GCTTCGGATCCAAATCCACCCCTGTCATCGGCGGGAATACCTTCAATTTAAAGTACAGCCGGAATAATGAAAAGAACCG
GATTGTTATCCCTTTCAGCTTCGCCTGGCCGAGATCCTACACGTTGCTTGTTGAGGCATGGGATTACAATGATAACTCT
ACTAATCCCGATCGCATAATTGAGAAGGCATCCCACTCTGGCATGATCAATCCAAGCCGTCAGTGGCAGACGTTGAAAC
ATAACACAGGAGCTGCCCACTTTGAGTATCAAATCCGTGTGACTTGCGCAGAACATTACTATGGCTTTGGATGCAACAA
GTTTTGTCGACCGAGAGATGACTTCTTCACTCACCATACCTGTGACCAGAATGGCAACAAAACCTGCTTGGAAGGCTGG
ACGGGACCAGAATGCAACAAAGCTATTTGTCGTCAGGGATGTAGCCCCAAGCATGGTTCTTGCACAGTTCCAGGAGAGT
GCAGGTGTCAATATGGATGGCAAGGCCAGTACTGTGATAAGTGCATTCCACACCCAGGATGTGTCCATGGCACTTGCAT
TGAACCATGGCAGTGCCTCTGTGAAACCAACTGGGGTGGTCAGCTCTGTGACAAAGACCTGAACTACTGTGGAACCCAC
CCACCCTGTTTGAATGGTGGTACCTGCAGCAACACTGGCCCCGATAAATACCAGTGTTCCTGCCCTGAGGGTTACTCAG
GACAGAACTGTGAAATAGCGGAGCACGCGTGCCTCTCTGATCCGTGCCACAACGGAGGAAGCTGCCTAGAAACGTCTAC
AGGATTTGAATGTGTGTGTGCACCTGGCTGGGCTGGACCAACTTGCACTGATAATATTGATGATTGTTCTCCAAATCCC
TGTGGTCATGGAGGAACTTGCCAAGATCTAGTTGATGGATTTAAGTGTATTTGCCCACCTCAGTGGACTGGCAAAACAT
GCCAGCTAGATGCGAATGAATGTGAGGGCAAACCCTGTGTCAATGCCAACTCCTGCAGGAACCTGATTGGCAGCTACTA
TTGTGACTGCATTACTGGCTGGTCTGGCCACAACTGTGATATAAATATCAATGATTGTCGTGGACAATGTCAGAATGGA
GGATCCTGTCGGGACTTGGTTAATGGTTATCGGTGCATCTGTTCACCTGGCTATGCAGGAGATCACTGTGAGAAAGACA
TCAATGAATGTGCAAGTAACCCTTGCATGAATGGGGGTCACTGCCAGGATGAAATCAATGGATTCCAATGTCTGTGTCC
TGCTGGTTTCTCAGGAAACCTCTGTCAGCTGGATATAGACTACTGTGAGCCAAACCCTTGCCAGAACGGTGCCCAGTGC
TTCAATCTTGCTATGGACTATTTCTGTAACTGCCCTGAAGATTACGAAGGCAAGAACTGCTCCCACCTGAAAGATCACT
GCCGCACAACTCCTTGTGAAGTAATCGACAGCTGTACAGTGGCAGTGGCTTCTAACAGCACACCAGAAGGAGTTCGTTA
CATTTCTTCAAATGTCTGTGGTCCTCATGGAAAATGCAAGAGCCAAGCAGGTGGAAAATTCACCTGTGAATGCAACAAA
GGATTCACTGGCACCTACTGTCATGAGAATATCAATGACTGTGAGAGCAACCCCTGTAAAAATGGTGGCACTTGTATTG
ACGGTGTAAACTCCTACAAATGTATTTGTAGTGATGGATGGGAAGGAACATATTGTGAAACAAATATTAATGACTGCAG
TAAAAACCCCTGCCACAATGGAGGAACTTGCCGAGACTTGGTCAATGACTTCTTCTGTGAATGTAAAAATGGGTGGAAA
GGAAAAACTTGCCACTCTCGTGACAGCCAGTGTGATGAGGCAACATGCAATAATGGAGGAACATGTTATGATGAGGGGG
ACACTTTCAAGTGCATGTGTCCTGCAGGATGGGAAGGAGCCACTTGTAATATAGCAAGGAACAGCAGCTGCCTGCCAAA
CCCCTGTCACAATGGTGGTACCTGTGTAGTTAGTGGGGATTCTTTCACTTGTGTCTGCAAGGAGGGCTGGGAAGGACCG
ACATGCACTCAGAACACAAATGACTGCAGTCCTCATCCTTGTTACAACAGTGGTACTTGTGTGGATGGAGACAACTGGT
ACCGCTGTGAGTGCGCTCCCGGCTTCGCAGGTCCCGACTGTAGGATCAACATCAATGAATGTCAGTCTTCACCCTGTGC
CTTTGGGGCTACTTGCGTGGATGAAATTAATGGGTACCGTTGCATTTGTCCACCGGGTCGCAGTGGTCCAGGATGCCAG
GAAGTTACAGGGAGGCCTTGCTTTACCAGTATTCGAGTAATGCCAGACGGTGCTAAGTGGGATGATGACTGTAATACTT
GTCAGTGTTTGAATGGAAAAGTCACCTGTTCTAAGGTTTGGTGTGGTCCTCGACCTTGTATAATACATGCCAAAGGTCA
TAATGAATGCCCAGCTGGACATGCTTGTGTTCCTGTTAAAGAAGACCATTGTTTCACTCATCCTTGTGCTGCAGTGGGT
GAATGCTGGCCTTCTAATCAACAACCTGTGAAGACCAAATGCAATTCTGATTCTTATTACCAAGATAATTGTGCCAACA
TCACCTTCACCTTTAATAAGGAAATGATGGCACCAGGCCTTACCACGGAGCACATTTGCAGTGAATTGAGGAATCTGAA
TATCCTGAAGAATGTTTCTGCTGAATATTCCATCTATATTACCTGTGAGCCTTCACACTTGGCAAATAATGAAATACAT
GTTGCTATTTCTGCTGAAGATATAGGAGAAGATGAAAACCCAATCAAGGAAATCACAGATAAGATTATTGACCTTGTCA
GTAAGCGTGATGGAAACAACACACTAATTGCTGCAGTCGCAGAAGTCAGAGTACAAAGGCGACCAGTTAAGAACAAAAC
AGATTTCTTGGTGCCATTACTGAGCTCAGTCTTAACAGTAGCCTGGATCTGCTGTCTGGTAACTGTTTTCTATTGGTGC
ATTCAAAAGCGCAGAAAGCAGAGCAGCCATACTCACACAGCATCTGATGACAACACCACCAACAACGTAAGGGAGCAGC
TGAATCAGATTAAAAACCCCATAGAGAAACACGGAGCAAATACTGTTCCAATTAAAGACTATGAAAACAAAAACTCTAA
AATCGCCAAAATAAGGACGCACAATTCAGAAGTGGAGGAAGATGACATGGACAAACACCAGCAAAAGGCCCGGTTTGCC
AAGCAGCCAGCGTACACTTTGGTAGACAGAGATGAAAAGCCACCCAACAGCACACCCACAAAACACCCAAACTGGACAA
ATAAACAGGACAACAGAGACTTGGAAAGTGCACAAAGTTTAAATAGAATGGAGTACATTGTATAGCAGACAGTTGGGTG
CTGCCATGCAGGGCCTTTAAATATCGTTATAAAGGCACTCAAGAGCTTGTAGTTCTTAAACTGTTGTGTAATATTTGAG
TCTAAGGCTATTATTTACTTAGAGTCCCTCTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGATAGTTGC
TGTGGTTGGCTGGAATACCAAGTGCTGCATTTCACATCTATGCAAAACTAGTCAAAAGTGCCCTAATGTAAATTCAGCT
GTAGCTGATACATCATGGAAACGTTTCATAAGGTATTACATAGCCTTATTACTCTTCCTTAGTGTTAATTTTTTTTTCT
GCCAGATGTCCCAATTTATACAGTTTCTTTAGAATAATACATTTTATTTATATTTATTGAATCTGAGTTTTTTGTATAT
TGGTTTTATGGTGACGTACAACTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCGGAACCACAGCAACTATCAAAAATA
AGTTTATTATTTATTTTTTTATTGTATTTTTGTTGGGGGAGGGTGGGGGGAACTTGTCAGCAGTTGCTGGTAAATGAAG
AATTTAAAGAGGAAAATGTGTCAAAAATAGAAGTTTGTATAGATATGTAAATAATTCTTTTTTATTAATCACTGTGTAT
ATTTGATTTATTAACTTAATAATCGAGAGCCTTAAAATATCATTCCTTTTTATTTATATGTATGTGTTTAGAGTTGAAG
GTTTTTGATAGCATTGTAAGCTTGTGGCTTCTTCATTTTGGATTTATTTTCTTGTTACATGTTGCCTATATGCCAAAAC
TAAGGTGTTCTAAAATAGTTTATTTTTAATAGGACGGGCTTTCATGCCTTGATGCTGGTTTTTGTACAATGTCAAATGT
TTGAAACACCTTCCATAGTATCACTTTAAGACTATTTGTAAGTACTGACTGAGGCAGTTTAGATAATTAGACTAGAAAA
TTTTTTTTGCTGCTTTAGACTTGAAACCGAGTGACAGGCAGATAATCTGCTAAGAAGCAGTTTAAGGGAACAAAACTGA
GCTATTACTTTATGTAGATGAAATGTGAGTGGTTGCATGTAATTAAAATATCAAATTAGCGTGTGAAGTTGGAAACACA
GCAATCTTATTTTGTAAATTCTGATTATTTTTTTTCTCACCATGAATATGTAATACTGAACCACTTGTAGATTTGAATT
TTTTTGTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGTTGAATACTTGAACAGTAGAATGTCCAGTAAGA
TCACTGTGTAGGTTTGCCATAGATTACACTGCCCGCCTTAACAAGTGAGGAAATCAAAGTGCTATTACAATGTTTAAGA
TCAAAAGGCTTATAAACATACTAATCTCGGTGGTTAACCATTGAGATCATGAAGATACCTTGTATTGTGATATTAGTGT
TATATGAAAATGCATCTTTGATGTGTTGTTCCTGGCAATAAATCTTGAAAAGTAATATTTATTAAATTTTTTTGTATGA
AAACATAAAAGAGCGTGGAGATTATTGAGCTTGGAACCACTCCCAACTGGTTAGTTGTGCTAAAACAGTGGCAGGTGAT
GGCTTACATTTCTAAGACCTGACACTGATTTTGGTGAAGTCTAGTTTTTGTTAGATGATTACATGTTTGTCTAGCTTTC
ATTCAAATTGAAGGGGTTCAAAAGCAACCTGGCCCTTGTTCTTGATGTCTTTTGGCTAATGTAACTCTGTGTCCTTTTG
AAAAGAGAATGATAATGTGACTGGAATTGTGCAACTAGTTTACTTTGCATGGGCCAATGAGCTACCACCAGATGGTAAC
CAAATCTAAGTAGCTAGGCAAGATACAAACTGCTGACCTGGATGGGAAAGGAGCCACAGATTATACTGATGCCTGATGG
GCAAAAAAATGCTTCATAAAGCATAAAATAAACTCTTAGAATATTCTGAAATGTCTCAGTGCTTAACTAATGCAGCCCC
TCCTGGCTTTGAGGGGCTGGGCGTGGAACTATTGGTCAGCTGAATGATACCCTGCTCTTTATTTTAGCACGTTTCTCAG
TGAAGCTTTAACTTTGCTTTGCTAAAGCTGATGGAAACATTAAGTAAGTAACAAACTCAGCTGACAAATAATATGAAAG
AGGTTCAGATTCCTTCTTGTATTTCAT
CitationSanders TA, Lumsden A, Ragsdale CW. Arcuate plan of chick midbrain development. J Neurosci. 2002 Dec 15;22(24):10742-50.
CopyrightCopyright © 2002-2011 by the Society for Neuroscience
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI, also known as" Jag 1". The cDNA sequence is the predicted sequence (acc# XM_415035.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-28
stage 28
stage 28
Mesencephalon
Midbrain
 

Entry 3

GEISHA IdJAG1.Paxton.2010Data SourcePublication
Complete cDNA Template Probeshow
CCTGTGGTCATGGAGGAACTTGCCAAGATCTAGTTGATGGATTTAAGTGTATTTGCCCACCTCAGTGGACTGGCAAAAC
ATGCCAGCTAGATGCGAATGAATGTGAGGGCAAACCCTGTGTCAATGCCAACTCCTGCAGGAACCTGATTGGCAGCTAC
TATTGTGACTGCATTACTGGCTGGTCTGGCCACAACTGTGATATAAATATCAATGATTGTCGTGGACAATGTCAGAATG
GAGGATCCTGTCGGGACTTGGTTAATGGTTATCGGTGCATCTGTTCACCTGGCTATGCAGGAGATCACTGTGAGAAAGA
CATCAATGAATGTGCAAGTAACCCTTGCATGAATGGGGGTCACTGCCAGGATGAAATCAATGGATTCCAATGTCTGTGT
CCTGCTGGTTTCTCAGGAAACCTCTGTCAGCTGGATATAGACTACTGTGAGCCAAACCCTTGCCAGAACGGTGCCCAGT
GCTTCAATCTTGCTATGGACTATTTCTGTAACTGCCCTGAAGATTACGAAGGCAAGAACTGCTCCCACCTGAAAGATCA
CTGCCGCACAACTCCTTGTGAAGTAATCGACAGCTGTACAGTGGCAGTGGCTTCTAACAGCACACCAGAAGGAGTTCGT
TACATTTCTTCAAATGTCTGTGGTCCTCATGGAAAATGCAAGAGCCAAGCAGGTGGAAAATTCACCTGTGAATGCAACA
AAGGATTCACTGGCACC
CitationPaxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010 Jan;10(1):31-43. Epub 2009 Nov 11.
Copyright 2009 Elsevier B.V. All rights reserved.
CommentsThe cDNA template used to generate the probe was obtained by PCR as described Jag1 (5-cctgtggtcatggaggaact-3; 5-ggtgccagtgaatcctttgt-3)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
Epiblast
Hensen's Node
Primitive Streak
 
7-12
stage 7
stage 7
stage 9
stage 11
Anterior Intestinal Portal
Anterior/Second Heart Field
Early Mesoderm
Epiblast
Heart Tube
Neural Plate/Tube
Splanchnic Mesoderm
 
13-18
stage 15
stage 15
Ear/Otic Placode
Forebrain
Head Mesenchyme
Heart Tube
Lens
Mesonephros
Midbrain
Neural Plate/Tube
Pineal Gland
 
19
stage 19
stage 19
stage 19
Allantois
Ear/Otic Placode
Heart Tube
Hindbrain
Lens
Mesonephros
Midbrain
Neural Plate/Tube
Pharyngeal Arches and Clefts
Pineal Gland
Pronephros
 

Entry 4

GEISHA IdSER1.Sienknecht.2009Data SourcePublication
Complete cDNA Template Probeshow
ATGCGTGCGGCCCGGCGGGCGGCGGCGCGCTCCCTCGTCCTCTTCCTGGCCCTGCTGGGGCTGCGGGCTCAGGTACGTT
CGGGGGGCGGGAGCGGTTCCCGCGGCGTTTGCTGGAGGGGGTCCCGGAGCTGCGGAGGCTGCGGGGCGGCTCGGCGGGA
GCGCGGGCGGTGGTGCCGGCTGTCCTGCGGGGAGGGCAGCGGTCCGTGTGGCGAGGCGAGGCGAGGCGAGGTTCCTCGA
GGATCCAAGTGCCAGCTGCCGCAGGTTGTGTTTGGGGTGAAAGGTGAGGTGGCGTCAGCATCGGGACAGTTCGAGCTGG
AGATCTTATCCGTGCAGAATGTGAACGGCGTGCTGCAGAACGGGAACTGCTGCGACGGCACTCGAAACCCCGGAGATAA
AAAGTGCACCAGAGATGAGTGTGACACCTACTTTAAAGTTTGCCTGAAGGAGTACCAGTCGCGGGTCACTGCTGGCGGC
CCTTGCAGCTTCGGATCCAAATCCACCCCTGTCATCGGCGGGAATACCTTCAATTTAAAGTACAGCCGGAATAATGAAA
AGAACCGGATTGTTATCCCTTTCAGCTTCGCCTGGCCGAGATCCTACACGTTGCTTGTTGAGGCATGGGATTACAATGA
TAACTCTACTAATCCCGATCGCATAATTGAGAAGGCATCCCACTCTGGCATGATCAATCCAAGCCGTCAGTGGCAGACG
TTGAAACATAACACAGGAGCTGCCCACTTTGAGTATCAAATCCGTGTGACTTGCGCAGAACATTACTATGGCTTTGGAT
GCAACAAGTTTTGTCGACCGAGAGATGACTTCTTCACTCACCATACCTGTGACCAGAATGGCAACAAAACCTGCTTGGA
AGGCTGGACGGGACCAGAATGCAACAAAGCTATTTGTCGTCAGGGATGTAGCCCCAAGCATGGTTCTTGCACAGTTCCA
GGAGAGTGCAGGTGTCAATATGGATGGCAAGGCCAGTACTGTGATAAGTGCATTCCACACCCAGGATGTGTCCATGGCA
CTTGCATTGAACCATGGCAGTGCCTCTGTGAAACCAACTGGGGTGGTCAGCTCTGTGACAAAGACCTGAACTACTGTGG
AACCCACCCACCCTGTTTGAATGGTGGTACCTGCAGCAACACTGGCCCCGATAAATACCAGTGTTCCTGCCCTGAGGGT
TACTCAGGACAGAACTGTGAAATAGCGGAGCACGCGTGCCTCTCTGATCCGTGCCACAACGGAGGAAGCTGCCTAGAAA
CGTCTACAGGATTTGAATGTGTGTGTGCACCTGGCTGGGCTGGACCAACTTGCACTGATAATATTGATGATTGTTCTCC
AAATCCCTGTGGTCATGGAGGAACTTGCCAAGATCTAGTTGATGGATTTAAGTGTATTTGCCCACCTCAGTGGACTGGC
AAAACATGCCAGCTAGATGCGAATGAATGTGAGGGCAAACCCTGTGTCAATGCCAACTCCTGCAGGAACCTGATTGGCA
GCTACTATTGTGACTGCATTACTGGCTGGTCTGGCCACAACTGTGATATAAATATCAATGATTGTCGTGGACAATGTCA
GAATGGAGGATCCTGTCGGGACTTGGTTAATGGTTATCGGTGCATCTGTTCACCTGGCTATGCAGGAGATCACTGTGAG
AAAGACATCAATGAATGTGCAAGTAACCCTTGCATGAATGGGGGTCACTGCCAGGATGAAATCAATGGATTCCAATGTC
TGTGTCCTGCTGGTTTCTCAGGAAACCTCTGTCAGCTGGATATAGACTACTGTGAGCCAAACCCTTGCCAGAACGGTGC
CCAGTGCTTCAATCTTGCTATGGACTATTTCTGTAACTGCCCTGAAGATTACGAAGGCAAGAACTGCTCCCACCTGAAA
GATCACTGCCGCACAACTCCTTGTGAAGTAATCGACAGCTGTACAGTGGCAGTGGCTTCTAACAGCACACCAGAAGGAG
TTCGTTACATTTCTTCAAATGTCTGTGGTCCTCATGGAAAATGCAAGAGCCAAGCAGGTGGAAAATTCACCTGTGAATG
CAACAAAGGATTCACTGGCACCTACTGTCATGAGAATATCAATGACTGTGAGAGCAACCCCTGTAAAAATGGTGGCACT
TGTATTGACGGTGTAAACTCCTACAAATGTATTTGTAGTGATGGATGGGAAGGAACATATTGTGAAACAAATATTAATG
ACTGCAGTAAAAACCCCTGCCACAATGGAGGAACTTGCCGAGACTTGGTCAATGACTTCTTCTGTGAATGTAAAAATGG
GTGGAAAGGAAAAACTTGCCACTCTCGTGACAGCCAGTGTGATGAGGCAACATGCAATAATGGAGGAACATGTTATGAT
GAGGGGGACACTTTCAAGTGCATGTGTCCTGCAGGATGGGAAGGAGCCACTTGTAATATAGCAAGGAACAGCAGCTGCC
TGCCAAACCCCTGTCACAATGGTGGTACCTGTGTAGTTAGTGGGGATTCTTTCACTTGTGTCTGCAAGGAGGGCTGGGA
AGGACCGACATGCACTCAGAACACAAATGACTGCAGTCCTCATCCTTGTTACAACAGTGGTACTTGTGTGGATGGAGAC
AACTGGTACCGCTGTGAGTGCGCTCCCGGCTTCGCAGGTCCCGACTGTAGGATCAACATCAATGAATGTCAGTCTTCAC
CCTGTGCCTTTGGGGCTACTTGCGTGGATGAAATTAATGGGTACCGTTGCATTTGTCCACCGGGTCGCAGTGGTCCAGG
ATGCCAGGAAGTTACAGGGAGGCCTTGCTTTACCAGTATTCGAGTAATGCCAGACGGTGCTAAGTGGGATGATGACTGT
AATACTTGTCAGTGTTTGAATGGAAAAGTCACCTGTTCTAAGGTTTGGTGTGGTCCTCGACCTTGTATAATACATGCCA
AAGGTCATAATGAATGCCCAGCTGGACATGCTTGTGTTCCTGTTAAAGAAGACCATTGTTTCACTCATCCTTGTGCTGC
AGTGGGTGAATGCTGGCCTTCTAATCAACAACCTGTGAAGACCAAATGCAATTCTGATTCTTATTACCAAGATAATTGT
GCCAACATCACCTTCACCTTTAATAAGGAAATGATGGCACCAGGCCTTACCACGGAGCACATTTGCAGTGAATTGAGGA
ATCTGAATATCCTGAAGAATGTTTCTGCTGAATATTCCATCTATATTACCTGTGAGCCTTCACACTTGGCAAATAATGA
AATACATGTTGCTATTTCTGCTGAAGATATAGGAGAAGATGAAAACCCAATCAAGGAAATCACAGATAAGATTATTGAC
CTTGTCAGTAAGCGTGATGGAAACAACACACTAATTGCTGCAGTCGCAGAAGTCAGAGTACAAAGGCGACCAGTTAAGA
ACAAAACAGATTTCTTGGTGCCATTACTGAGCTCAGTCTTAACAGTAGCCTGGATCTGCTGTCTGGTAACTGTTTTCTA
TTGGTGCATTCAAAAGCGCAGAAAGCAGAGCAGCCATACTCACACAGCATCTGATGACAACACCACCAACAACGTAAGG
GAGCAGCTGAATCAGATTAAAAACCCCATAGAGAAACACGGAGCAAATACTGTTCCAATTAAAGACTATGAAAACAAAA
ACTCTAAAATCGCCAAAATAAGGACGCACAATTCAGAAGTGGAGGAAGATGACATGGACAAACACCAGCAAAAGGCCCG
GTTTGCCAAGCAGCCAGCGTACACTTTGGTAGACAGAGATGAAAAGCCACCCAACAGCACACCCACAAAACACCCAAAC
TGGACAAATAAACAGGACAACAGAGACTTGGAAAGTGCACAAAGTTTAAATAGAATGGAGTACATTGTATAGCAGACAG
TTGGGTGCTGCCATGCAGGGCCTTTAAATATCGTTATAAAGGCACTCAAGAGCTTGTAGTTCTTAAACTGTTGTGTAAT
ATTTGAGTCTAAGGCTATTATTTACTTAGAGTCCCTCTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGA
TAGTTGCTGTGGTTGGCTGGAATACCAAGTGCTGCATTTCACATCTATGCAAAACTAGTCAAAAGTGCCCTAATGTAAA
TTCAGCTGTAGCTGATACATCATGGAAACGTTTCATAAGGTATTACATAGCCTTATTACTCTTCCTTAGTGTTAATTTT
TTTTTCTGCCAGATGTCCCAATTTATACAGTTTCTTTAGAATAATACATTTTATTTATATTTATTGAATCTGAGTTTTT
TGTATATTGGTTTTATGGTGACGTACAACTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCGGAACCACAGCAACTATC
AAAAATAAGTTTATTATTTATTTTTTTATTGTATTTTTGTTGGGGGAGGGTGGGGGGAACTTGTCAGCAGTTGCTGGTA
AATGAAGAATTTAAAGAGGAAAATGTGTCAAAAATAGAAGTTTGTATAGATATGTAAATAATTCTTTTTTATTAATCAC
TGTGTATATTTGATTTATTAACTTAATAATCGAGAGCCTTAAAATATCATTCCTTTTTATTTATATGTATGTGTTTAGA
GTTGAAGGTTTTTGATAGCATTGTAAGCTTGTGGCTTCTTCATTTTGGATTTATTTTCTTGTTACATGTTGCCTATATG
CCAAAACTAAGGTGTTCTAAAATAGTTTATTTTTAATAGGACGGGCTTTCATGCCTTGATGCTGGTTTTTGTACAATGT
CAAATGTTTGAAACACCTTCCATAGTATCACTTTAAGACTATTTGTAAGTACTGACTGAGGCAGTTTAGATAATTAGAC
TAGAAAATTTTTTTTGCTGCTTTAGACTTGAAACCGAGTGACAGGCAGATAATCTGCTAAGAAGCAGTTTAAGGGAACA
AAACTGAGCTATTACTTTATGTAGATGAAATGTGAGTGGTTGCATGTAATTAAAATATCAAATTAGCGTGTGAAGTTGG
AAACACAGCAATCTTATTTTGTAAATTCTGATTATTTTTTTTCTCACCATGAATATGTAATACTGAACCACTTGTAGAT
TTGAATTTTTTTGTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGTTGAATACTTGAACAGTAGAATGTCC
AGTAAGATCACTGTGTAGGTTTGCCATAGATTACACTGCCCGCCTTAACAAGTGAGGAAATCAAAGTGCTATTACAATG
TTTAAGATCAAAAGGCTTATAAACATACTAATCTCGGTGGTTAACCATTGAGATCATGAAGATACCTTGTATTGTGATA
TTAGTGTTATATGAAAATGCATCTTTGATGTGTTGTTCCTGGCAATAAATCTTGAAAAGTAATATTTATTAAATTTTTT
TGTATGAAAACATAAAAGAGCGTGGAGATTATTGAGCTTGGAACCACTCCCAACTGGTTAGTTGTGCTAAAACAGTGGC
AGGTGATGGCTTACATTTCTAAGACCTGACACTGATTTTGGTGAAGTCTAGTTTTTGTTAGATGATTACATGTTTGTCT
AGCTTTCATTCAAATTGAAGGGGTTCAAAAGCAACCTGGCCCTTGTTCTTGATGTCTTTTGGCTAATGTAACTCTGTGT
CCTTTTGAAAAGAGAATGATAATGTGACTGGAATTGTGCAACTAGTTTACTTTGCATGGGCCAATGAGCTACCACCAGA
TGGTAACCAAATCTAAGTAGCTAGGCAAGATACAAACTGCTGACCTGGATGGGAAAGGAGCCACAGATTATACTGATGC
CTGATGGGCAAAAAAATGCTTCATAAAGCATAAAATAAACTCTTAGAATATT
CitationSienknecht UJ, Fekete DM. Mapping of Wnt, frizzled, and Wnt inhibitor gene expression domains in the avian otic primordium. J Comp Neurol. 2009 Dec 20;517(6):751-64.
CopyrightCopyright © (2002 Wiley-Liss); This material is used by permission of Wiley-Liss, Inc., a subsidiary of John Wiley & Sons, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #X95283.1 ).
no images

Entry 5

GEISHA IdSERRATE1.Daudet.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGCGTGCGGCCCGGCGGGCGGCGGCGCGCTCCCTCGTCCTCTTCCTGGCCCTGCTGGGGCTGCGGGCTCAGGTACGTT
CGGGGGGCGGGAGCGGTTCCCGCGGCGTTTGCTGGAGGGGGTCCCGGAGCTGCGGAGGCTGCGGGGCGGCTCGGCGGGA
GCGCGGGCGGTGGTGCCGGCTGTCCTGCGGGGAGGGCAGCGGTCCGTGTGGCGAGGCGAGGCGAGGCGAGGTTCCTCGA
GGATCCAAGTGCCAGCTGCCGCAGGTTGTGTTTGGGGTGAAAGGTGAGGTGGCGTCAGCATCGGGACAGTTCGAGCTGG
AGATCTTATCCGTGCAGAATGTGAACGGCGTGCTGCAGAACGGGAACTGCTGCGACGGCACTCGAAACCCCGGAGATAA
AAAGTGCACCAGAGATGAGTGTGACACCTACTTTAAAGTTTGCCTGAAGGAGTACCAGTCGCGGGTCACTGCTGGCGGC
CCTTGCAGCTTCGGATCCAAATCCACCCCTGTCATCGGCGGGAATACCTTCAATTTAAAGTACAGCCGGAATAATGAAA
AGAACCGGATTGTTATCCCTTTCAGCTTCGCCTGGCCGAGATCCTACACGTTGCTTGTTGAGGCATGGGATTACAATGA
TAACTCTACTAATCCCGATCGCATAATTGAGAAGGCATCCCACTCTGGCATGATCAATCCAAGCCGTCAGTGGCAGACG
TTGAAACATAACACAGGAGCTGCCCACTTTGAGTATCAAATCCGTGTGACTTGCGCAGAACATTACTATGGCTTTGGAT
GCAACAAGTTTTGTCGACCGAGAGATGACTTCTTCACTCACCATACCTGTGACCAGAATGGCAACAAAACCTGCTTGGA
AGGCTGGACGGGACCAGAATGCAACAAAGCTATTTGTCGTCAGGGATGTAGCCCCAAGCATGGTTCTTGCACAGTTCCA
GGAGAGTGCAGGTGTCAATATGGATGGCAAGGCCAGTACTGTGATAAGTGCATTCCACACCCAGGATGTGTCCATGGCA
CTTGCATTGAACCATGGCAGTGCCTCTGTGAAACCAACTGGGGTGGTCAGCTCTGTGACAAAGACCTGAACTACTGTGG
AACCCACCCACCCTGTTTGAATGGTGGTACCTGCAGCAACACTGGCCCCGATAAATACCAGTGTTCCTGCCCTGAGGGT
TACTCAGGACAGAACTGTGAAATAGCGGAGCACGCGTGCCTCTCTGATCCGTGCCACAACGGAGGAAGCTGCCTAGAAA
CGTCTACAGGATTTGAATGTGTGTGTGCACCTGGCTGGGCTGGACCAACTTGCACTGATAATATTGATGATTGTTCTCC
AAATCCCTGTGGTCATGGAGGAACTTGCCAAGATCTAGTTGATGGATTTAAGTGTATTTGCCCACCTCAGTGGACTGGC
AAAACATGCCAGCTAGATGCGAATGAATGTGAGGGCAAACCCTGTGTCAATGCCAACTCCTGCAGGAACCTGATTGGCA
GCTACTATTGTGACTGCATTACTGGCTGGTCTGGCCACAACTGTGATATAAATATCAATGATTGTCGTGGACAATGTCA
GAATGGAGGATCCTGTCGGGACTTGGTTAATGGTTATCGGTGCATCTGTTCACCTGGCTATGCAGGAGATCACTGTGAG
AAAGACATCAATGAATGTGCAAGTAACCCTTGCATGAATGGGGGTCACTGCCAGGATGAAATCAATGGATTCCAATGTC
TGTGTCCTGCTGGTTTCTCAGGAAACCTCTGTCAGCTGGATATAGACTACTGTGAGCCAAACCCTTGCCAGAACGGTGC
CCAGTGCTTCAATCTTGCTATGGACTATTTCTGTAACTGCCCTGAAGATTACGAAGGCAAGAACTGCTCCCACCTGAAA
GATCACTGCCGCACAACTCCTTGTGAAGTAATCGACAGCTGTACAGTGGCAGTGGCTTCTAACAGCACACCAGAAGGAG
TTCGTTACATTTCTTCAAATGTCTGTGGTCCTCATGGAAAATGCAAGAGCCAAGCAGGTGGAAAATTCACCTGTGAATG
CAACAAAGGATTCACTGGCACCTACTGTCATGAGAATATCAATGACTGTGAGAGCAACCCCTGTAAAAATGGTGGCACT
TGTATTGACGGTGTAAACTCCTACAAATGTATTTGTAGTGATGGATGGGAAGGAACATATTGTGAAACAAATATTAATG
ACTGCAGTAAAAACCCCTGCCACAATGGAGGAACTTGCCGAGACTTGGTCAATGACTTCTTCTGTGAATGTAAAAATGG
GTGGAAAGGAAAAACTTGCCACTCTCGTGACAGCCAGTGTGATGAGGCAACATGCAATAATGGAGGAACATGTTATGAT
GAGGGGGACACTTTCAAGTGCATGTGTCCTGCAGGATGGGAAGGAGCCACTTGTAATATAGCAAGGAACAGCAGCTGCC
TGCCAAACCCCTGTCACAATGGTGGTACCTGTGTAGTTAGTGGGGATTCTTTCACTTGTGTCTGCAAGGAGGGCTGGGA
AGGACCGACATGCACTCAGAACACAAATGACTGCAGTCCTCATCCTTGTTACAACAGTGGTACTTGTGTGGATGGAGAC
AACTGGTACCGCTGTGAGTGCGCTCCCGGCTTCGCAGGTCCCGACTGTAGGATCAACATCAATGAATGTCAGTCTTCAC
CCTGTGCCTTTGGGGCTACTTGCGTGGATGAAATTAATGGGTACCGTTGCATTTGTCCACCGGGTCGCAGTGGTCCAGG
ATGCCAGGAAGTTACAGGGAGGCCTTGCTTTACCAGTATTCGAGTAATGCCAGACGGTGCTAAGTGGGATGATGACTGT
AATACTTGTCAGTGTTTGAATGGAAAAGTCACCTGTTCTAAGGTTTGGTGTGGTCCTCGACCTTGTATAATACATGCCA
AAGGTCATAATGAATGCCCAGCTGGACATGCTTGTGTTCCTGTTAAAGAAGACCATTGTTTCACTCATCCTTGTGCTGC
AGTGGGTGAATGCTGGCCTTCTAATCAACAACCTGTGAAGACCAAATGCAATTCTGATTCTTATTACCAAGATAATTGT
GCCAACATCACCTTCACCTTTAATAAGGAAATGATGGCACCAGGCCTTACCACGGAGCACATTTGCAGTGAATTGAGGA
ATCTGAATATCCTGAAGAATGTTTCTGCTGAATATTCCATCTATATTACCTGTGAGCCTTCACACTTGGCAAATAATGA
AATACATGTTGCTATTTCTGCTGAAGATATAGGAGAAGATGAAAACCCAATCAAGGAAATCACAGATAAGATTATTGAC
CTTGTCAGTAAGCGTGATGGAAACAACACACTAATTGCTGCAGTCGCAGAAGTCAGAGTACAAAGGCGACCAGTTAAGA
ACAAAACAGATTTCTTGGTGCCATTACTGAGCTCAGTCTTAACAGTAGCCTGGATCTGCTGTCTGGTAACTGTTTTCTA
TTGGTGCATTCAAAAGCGCAGAAAGCAGAGCAGCCATACTCACACAGCATCTGATGACAACACCACCAACAACGTAAGG
GAGCAGCTGAATCAGATTAAAAACCCCATAGAGAAACACGGAGCAAATACTGTTCCAATTAAAGACTATGAAAACAAAA
ACTCTAAAATCGCCAAAATAAGGACGCACAATTCAGAAGTGGAGGAAGATGACATGGACAAACACCAGCAAAAGGCCCG
GTTTGCCAAGCAGCCAGCGTACACTTTGGTAGACAGAGATGAAAAGCCACCCAACAGCACACCCACAAAACACCCAAAC
TGGACAAATAAACAGGACAACAGAGACTTGGAAAGTGCACAAAGTTTAAATAGAATGGAGTACATTGTATAGCAGACAG
TTGGGTGCTGCCATGCAGGGCCTTTAAATATCGTTATAAAGGCACTCAAGAGCTTGTAGTTCTTAAACTGTTGTGTAAT
ATTTGAGTCTAAGGCTATTATTTACTTAGAGTCCCTCTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGA
TAGTTGCTGTGGTTGGCTGGAATACCAAGTGCTGCATTTCACATCTATGCAAAACTAGTCAAAAGTGCCCTAATGTAAA
TTCAGCTGTAGCTGATACATCATGGAAACGTTTCATAAGGTATTACATAGCCTTATTACTCTTCCTTAGTGTTAATTTT
TTTTTCTGCCAGATGTCCCAATTTATACAGTTTCTTTAGAATAATACATTTTATTTATATTTATTGAATCTGAGTTTTT
TGTATATTGGTTTTATGGTGACGTACAACTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCGGAACCACAGCAACTATC
AAAAATAAGTTTATTATTTATTTTTTTATTGTATTTTTGTTGGGGGAGGGTGGGGGGAACTTGTCAGCAGTTGCTGGTA
AATGAAGAATTTAAAGAGGAAAATGTGTCAAAAATAGAAGTTTGTATAGATATGTAAATAATTCTTTTTTATTAATCAC
TGTGTATATTTGATTTATTAACTTAATAATCGAGAGCCTTAAAATATCATTCCTTTTTATTTATATGTATGTGTTTAGA
GTTGAAGGTTTTTGATAGCATTGTAAGCTTGTGGCTTCTTCATTTTGGATTTATTTTCTTGTTACATGTTGCCTATATG
CCAAAACTAAGGTGTTCTAAAATAGTTTATTTTTAATAGGACGGGCTTTCATGCCTTGATGCTGGTTTTTGTACAATGT
CAAATGTTTGAAACACCTTCCATAGTATCACTTTAAGACTATTTGTAAGTACTGACTGAGGCAGTTTAGATAATTAGAC
TAGAAAATTTTTTTTGCTGCTTTAGACTTGAAACCGAGTGACAGGCAGATAATCTGCTAAGAAGCAGTTTAAGGGAACA
AAACTGAGCTATTACTTTATGTAGATGAAATGTGAGTGGTTGCATGTAATTAAAATATCAAATTAGCGTGTGAAGTTGG
AAACACAGCAATCTTATTTTGTAAATTCTGATTATTTTTTTTCTCACCATGAATATGTAATACTGAACCACTTGTAGAT
TTGAATTTTTTTGTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGTTGAATACTTGAACAGTAGAATGTCC
AGTAAGATCACTGTGTAGGTTTGCCATAGATTACACTGCCCGCCTTAACAAGTGAGGAAATCAAAGTGCTATTACAATG
TTTAAGATCAAAAGGCTTATAAACATACTAATCTCGGTGGTTAACCATTGAGATCATGAAGATACCTTGTATTGTGATA
TTAGTGTTATATGAAAATGCATCTTTGATGTGTTGTTCCTGGCAATAAATCTTGAAAAGTAATATTTATTAAATTTTTT
TGTATGAAAACATAAAAGAGCGTGGAGATTATTGAGCTTGGAACCACTCCCAACTGGTTAGTTGTGCTAAAACAGTGGC
AGGTGATGGCTTACATTTCTAAGACCTGACACTGATTTTGGTGAAGTCTAGTTTTTGTTAGATGATTACATGTTTGTCT
AGCTTTCATTCAAATTGAAGGGGTTCAAAAGCAACCTGGCCCTTGTTCTTGATGTCTTTTGGCTAATGTAACTCTGTGT
CCTTTTGAAAAGAGAATGATAATGTGACTGGAATTGTGCAACTAGTTTACTTTGCATGGGCCAATGAGCTACCACCAGA
TGGTAACCAAATCTAAGTAGCTAGGCAAGATACAAACTGCTGACCTGGATGGGAAAGGAGCCACAGATTATACTGATGC
CTGATGGGCAAAAAAATGCTTCATAAAGCATAAAATAAACTCTTAGAATATT
CitationDaudet N, Ariza-McNaughton L, Lewis J. Notch signalling is needed to maintain, but not to initiate, the formation of prosensory patches in the chick inner ear. Development. 2007 Jun;134(12):2369-78.
CopyrightCopyright 2007 the authors. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # XM_415035.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
Neural Plate/Tube
Surface Ectoderm
 
13-18
stage 13
stage 17
stage 18
stage 18
Ear/Otic Placode
Neural Plate/Tube
 

Entry 6

GEISHA IdC-Serrate-1.Hayashi.1996Data SourcePublication
Complete cDNA Template Probeshow
TTTAAAGTTTGCCTGAAGGAGTACCAGTCGCGGGTCACTGCTGGCGGCCCTTGCAGCTTCGGATCCAAATCCACCCCTG
TCATCGGCGGGAATACCTTCAATTTAAAGTACAGCCGGAATAATGAAAAGAACCGGATTGTTATCCCTTTCAGCTTCGC
CTGGCCGAGATCCTACACGTTGCTTGTTGAGGCATGGGATTACAATGATAACTCTACTAATCCCGATCGCATAATTGAG
AAGGCATCCCACTCTGGCATGATCAATCCAAGCCGTCAGTGGCAGACGTTGAAACATAACACAGGAGCTGCCCACTTTG
AGTATCAAATCCGTGTGACTTGCGCAGAACATTACTATGGCTTTGGATGCAACAAGTTTTGTCGACCGAGAGATGACTT
CTTCACTCACCATACCTGTGACCAGAATGGCAACAAAACCTGCTTGGAAGGCTGGACGGGACCAGAATGCAACAAAGCT
ATTTGTCGTCAGGGATGTAGCCCCAAGCATGGTTCTTGCACAGTTCCAGGAGAGTGCAGGTGTCAGTATGGATGGCAAG
GCCAGTACTGTGATAAGTGCATTCCACACCCGGGATGTGTCCATGGCACTTGCATTGAACCATGGCAGTGCCTCTGTGA
AACCAACTGGGGTGGTCAGCTCTGTGACAAAGACCTGAACTACTGTGGAACCC
CitationHayashi H, Mochii M, Kodama R, Hamada Y, Mizuno N, Eguchi G, Tachi C. Isolation of a novel chick homolog of Serrate and its coexpression with C-Notch-1 in chick development. Int J Dev Biol. 1996 Dec;40(6):1089-96.
Copyright© UBC Press
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Hayashi et al. 1996. C-Serrate-1 is also known as JAG1 in NCBI.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25
stage 25
stage 25
Diencephalon
Limb Buds
 

Entry 7

GEISHA IdJAG1.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
AGACGGGCGGCGGGCGGTGCGTGCGCTGCATGTGCGTGTGTGTATGTGTGTATGTGTGCGTGGTGTGTGTGCGTGTGTG
TCCCGGGGGGCGCCTCCGCCGCGCGCTGCCCGGCGACCTGAAAGCAATAAAAGGATCGGGATAATAATCGCGATAATAA
AATAAAAGAGAAAAGAAAAGGCGGACGACAAAAAGAAAGGAGAAAAAAAAAAAAAAAGAAAGAGGGAGGCGAGAGAATA
AGGAGAATAAAAGGAGGCCGGGCTGCTTTGCATTGAAGACCGGGGCGCTATTGAAAGCGCCTGAAAAGCGGCGTTGTTC
GGCGCGGGCGCGGCGCGGTATATAGAGCGGGGCGGCGGCAGCGGCGGCGGCAGCGGCGTCTCCTCCTCCTTCTCCCTCC
GGCCCTCCCCGGCGCGTCCCGGAGCGAGCGGCGGCGGCGGCCTGCAGGCGGGCAGCGCGGCGGCGGCATGCGTGCGGCC
CGGCGGGCGGCGGCGCGCTCCCTCGTCCTCTTCCTGGCCCTGCTGGGGCTGCGGGCTCAGGTGGCGTCAGCATCGGGAC
AGTTCGAGCTGGAGATCTTATCCGTGCAGAATGTGAACGGCGTGCTGCAGAACGGGAACTGCTGCGACGGCACTCGAAA
CCCCGGAGATAAAAAGTGCACCAGAGATGAGTGTGACACCTACTTTAAAGTTTGCCTGAAGGAGTACCAGTCGCGGGTC
ACTGCTGGCGGCCCTTGCAGCTTCGGATCCAAATCCACCCCTGTCATCGGCGGGAATACCTTCAATTTAAAGTACAGCC
GGAATAATGAAAAGAACCGGATTGTTATCCCTTTCAGCTTCGCCTGGCCGAGATCCTACACGTTGCTTGTTGAGGCATG
GGATTACAATGATAACTCTACTAATCCCGATCGCATAATTGAGAAGGCATCCCACTCTGGCATGATCAATCCAAGCCGT
CAGTGGCAGACGTTGAAACATAACACAGGAGCTGCCCACTTTGAGTATCAAATCCGTGTGACTTGCGCAGAACATTACT
ATGGCTTTGGATGCAACAAGTTTTGTCGACCGAGAGATGACTTCTTCACTCACCATACCTGTGACCAGAATGGCAACAA
AACCTGCTTGGAAGGCTGGACGGGACCAGAATGCAACAAAGCTATTTGTCGTCAGGGATGTAGCCCCAAGCATGGTTCT
TGCACAGTTCCAGGAGAGTGCAGGTGTCAGTATGGATGGCAAGGCCAGTACTGTGATAAGTGCATTCCACACCCGGGAT
GTGTCCATGGCACTTGCATTGAACCATGGCAGTGCCTCTGTGAAACCAACTGGGGTGGTCAGCTCTGTGACAAAGACCT
GAACTACTGTGGAACCCACCCACCCTGTTTGAATGGTGGTACCTGCAGCAACACTGGCCCCGATAAATACCAGTGTTCC
TGCCCTGAGGGTTACTCAGGACAGAACTGTGAAATAGCGGAGCACGCGTGCCTCTCTGATCCGTGCCACAACGGAGGAA
GCTGCCTAGAAACGTCTACAGGATTTGAATGTGTGTGTGCACCTGGCTGGGCTGGACCAACTTGCACTGATAATATTGA
TGATTGTTCTCCAAATCCCTGTGGTCATGGAGGAACTTGCCAAGATCTAGTTGATGGATTTAAGTGTATTTGCCCACCT
CAGTGGACTGGCAAAACATGCCAGCTAGATGCGAATGAATGTGAGGGCAAACCCTGTGTCAATGCCAACTCCTGCAGGA
ACCTGATTGGCAGCTACTATTGTGACTGCATTACTGGCTGGTCTGGCCACAACTGTGATATAAATATCAATGATTGTCG
TGGACAATGTCAGAATGGAGGATCCTGTCGGGACTTGGTTAATGGTTATCGGTGCATCTGTTCACCTGGCTATGCAGGA
GATCACTGTGAGAAAGACATCAATGAATGTGCAAGTAACCCTTGCATGAATGGGGGTCACTGCCAGGATGAAATCAATG
GATTCCAATGTCTGTGTCCTGCTGGTTTCTCAGGAAACCTCTGTCAGCTGGATATAGACTACTGTGAGCCAAACCCTTG
CCAGAACGGTGCCCAGTGCTTCAATCTTGCTATGGACTATTTCTGTAACTGCCCTGAAGATTACGAAGGCAAGAACTGC
TCCCACCTGAAAGATCACTGCCGCACAACTCCTTGTGAAGTAATCGACAGCTGTACAGTGGCAGTGGCTTCTAACAGCA
CACCAGAAGGAGTTCGTTACATTTCTTCAAATGTCTGTGGTCCTCATGGAAAATGCAAGAGCCAAGCAGGTGGAAAATT
CACCTGTGAATGCAACAAAGGATTCACTGGCACCTACTGTCATGAGAATATCAATGACTGTGAGAGCAACCCCTGTAAA
AATGGTGGCACTTGTATTGATGGTGTAAACTCCTACAAATGTATTTGTAGTGATGGATGGGAAGGAACATATTGTGAAA
CAAATATTAATGACTGCAGTAAAAACCCCTGCCACAATGGAGGAACTTGCCGAGACTTGGTCAATGACTTCTTCTGTGA
ATGTAAAAATGGGTGGAAAGGAAAAACTTGCCACTCTCGTGACAGCCAGTGTGATGAGGCAACATGCAATAATGGAGGA
ACATGTTATGATGAGGGGGACACTTTCAAGTGCATGTGTCCTGCAGGATGGGAAGGAGCCACTTGTAATATAGCAAGGA
ACAGCAGCTGCCTGCCAAACCCCTGTCACAATGGTGGTACCTGTGTAGTTAGTGGGGATTCTTTCACTTGTGTCTGCAA
GGAGGGCTGGGAAGGACCGACATGTACTCAGAACACAAATGACTGCAGTCCTCATCCTTGTTACAACAGTGGTACTTGT
GTGGATGGAGACAACTGGTACCGCTGTGAGTGCGCTCCAGGCTTCGCAGGTCCCGACTGTAGGATCAACATCAATGAAT
GTCAGTCTTCACCCTGTGCCTTTGGGGCTACTTGTGTGGATGAAATTAATGGGTACCGTTGCATTTGTCCACCGGGTCG
CAGTGGTCCAGGATGCCAGGAAGTTACAGGGAGGCCTTGCTTTACCAGTATTCGAGTAATGCCAGACGGTGCTAAGTGG
GATGATGACTGTAATACTTGTCAGTGTTTGAATGGAAAAGTCACCTGTTCTAAGGTTTGGTGTGGTCCTCGACCTTGTA
TAATACATGCCAAAGGTCATAATGAATGCCCAGCTGGACACGCTTGTGTTCCTGTTAAAGAAGACCATTGTTTCACTCA
TCCTTGTGCTGCAGTGGGTGAATGCTGGCCTTCTAATCAGCAGCCTGTGAAGACCAAATGCAATTCTGATTCTTATTAC
CAAGATAATTGTGCCAACATCACCTTCACCTTTAATAAGGAAATGATGGCACCAGGCCTTACCACGGAGCACATTTGCA
GTGAATTGAGGAATCTGAATATCCTGAAGAATGTTTCTGCTGAATATTCCATCTATATTACCTGTGAGCCTTCACACTT
GGCAAATAATGAAATACATGTTGCTATTTCTGCTGAAGATATAGGAGAAGATGAAAACCCAATCAAGGAAATCACAGAT
AAGATTATTGACCTTGTCAGTAAGCGTGATGGAAACAACACACTAATTGCTGCAGTCGCGGAAGTCAGAGTACAAAGGC
GACCAGTTAAGAACAAAACAGATTTCTTGGTGCCATTACTGAGCTCAGTCTTAACAGTAGCCTGGATCTGCTGTCTGGT
AACTGTTTTCTATTGGTGCATTCAAAAGCGCAGAAAGCAGAGCAGCCATACTCACACAGCATCTGATGACAACACCACC
AACAACGTAAGGGAGCAGCTGAATCAGATTAAAAACCCCATAGAGAAACACGGAGCAAATACTGTTCCAATTAAAGACT
ATGAAAACAAAAACTCTAAAATCGCCAAAATAAGGACGCACAATTCAGAAGTGGAGGAAGATGACATGGACAAACACCA
GCAAAAGGCCCGGTTTGCCAAGCAGCCAGCGTACACTTTGGTAGACAGAGATGAAAAGCCACCCAACAGCACACCCACA
AAACACCCAAACTGGACAAATAAACAGGACAACAGAGACTTGGAAAGTGCACAAAGTTTAAATAGAATGGAGTACATTG
TATAGCAGACAGTTGGGTGCTGCCATGCAGGGCCTTTAAATATCATTATAAAGGCACTCAAGAGCTTGTAGTTCTTAAA
CTGTTGTGTAATATTTGAGTCTAAGGCTATTATTTACTTAGAGTCCCTCTGTTAATTTAAGTTTTGACAAGCTGGCTTA
CACTGGCAATGATAGTTGCTGTGGTTGGCTGGAATACCAAGTGCTGCATTTCACATCTATGCAAAACTAGTCAAAAGTG
CCCTAATGTAAATTCAGCTGTAGCTGATACATCATGGAAACGTTTCATAAGGTATTACATAGCCTTATTACTCTTCCTT
AGTGTTAATTTTTTTTCTGCCAGATGTCCCAATTTATACAGTTTCTTTAGAATAATACATTTTATTTATATTTATTGAA
TCTGAGTTTTTTTGTATATTGGTTTTATGGTGACGTACAACTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCGGAACC
ACAGCAACTATCAAAAATAAGTTTATTATTTATTTTTTTATTGTATTTTTGTTGGGGGAGGGTGGGGGGAACTTGTCAG
CAGTTGCTGGTAAATGAAGAATTTAAAGAGGAAAATGTGTCAAAAATAGAAGTTTGTATAGATATGTAAATAATTCTTT
TTTATTAATCACTGTGTATATTTGATTTATTAACTTAATAATCGAGAGCCTTAAAATATCATTCCTTTTTATTTATATG
TATGTGTTTAGAGTTGAAGGTTTTTGATAGCATTGTAAGCTTGTGGCTTCTTCATTTTGGATTTATTTTCTTGTTACAT
GTTGCCTATATGCCAAAACTAAGGTGTTCTAAAATAGTTTATTTTTAATAGGACGGGCTTTCATGCCTTGATGCTGGTT
TTTGTACAATGTCAAATGTTTGAAACACCTTCCATAGTATCACTTTAAGACTATTTGTAAGTACTGACTGAGGCAGTTT
AGATAATTAGACTAGAAAATTTTTTTTTGCTGCTTTAGACTTGAAACCGAGTGACAGGCAGATAATCTGCTAAGAAGCA
GTTTAAGGGAACAAAACTGAGCTATTACTTTATGTAGATGAAATGTGAGTGGTTGCATGTAATTAAAATATCAAATTAG
CGTGTGAAGTTGGAAACACAGCAATCTTATTTTGTAAATTCTGATTATTTTTTTTCTCACCATGAATATGTAATACTGA
ACCACTTGTAGATTTGAATTTTTTTGTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGTTGAATACTTGAA
CAGTAGAATGTCCAGTAAGATCACTGTGTAGGTTTGCCATAGATTACACTGCCCGCCTTAACAAGTGAGGAAATCAAAG
TGCTATTACAATGTTTAAGATCAAAAGGCTTATAAACATACTAATCTCGGTGGTTAACCATTGAGATCATGAAGATACC
TTGTATTGTGATATTAGTGTTATATGAAAATGCATCTTTGATGTGTTGTTCCTGGCAATAAATCTTGAAAAGTAATATT
TATTAAATTTTTTTGTATGAAAACATAAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_040668033 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.53615

Mouse

EmageMGI:1095416
EurexpressMGI:1095416
MGI GXDMGI:1095416

Frog

Xenbase485661

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-011128-4, ZDB-GENE-011128-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona