GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

RARB
retinoic acid receptor beta

Gene
Official SymbolRARB
Official Full Nameretinoic acid receptor beta
CGNC ID8589
also known asRARBETA, retinoic acid receptor beta|RAR-beta|nuclear receptor subfamily 1 group B member 2|retinoic acid receptor beta 2|retinoic acid receptor beta4'|retinoic acid receptor beta4M|retinoic acid receptor beta4M', Retinoic acid receptor beta
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205326
PolypeptideNP_990657
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.51498
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human5915ENSG00000077092MIM:180220
Mouse218772ENSMUSG00000017491All phenotypic alleles (6):Targeted, knock-out(4) Targeted, other(2) MGI:97857
Xenopus100488600, 100049144, 100485387, 397983481008, 484126
Zebrafish30606ENSDARG00000034117ZDB-GENE-980526-531ZFIN:ZDB-GENE-980526-531
Gene Ontology
Molecular Functionretinoic acid receptor activity, sequence-specific DNA binding, steroid hormone receptor activity, more...zinc ion binding
Biological Processbeak morphogenesis, limb morphogenesis, response to retinoic acid
Cellular Componentnucleus
Links to other databases
Entrez Gene396266
Ensembl GeneENSGALG00000011298
KEGGgga:396266

Entry 1

GEISHA IdRARb2.Cui.2003Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CCAACAGCCTACGTGCCAAAAAAGGGGCAGAGTTTGATGGAGTTGGGTGTACTTTTATGTGCCATTTTCCTCCACACCT
AGAGGAAAGCACTTTTGCAGGCATTCTGTACAGGGGGAATCATGTTTGACTGTATGGATGTTCTAGCAGTGAGCCCTGC
TCAGATGCTGGATTTCTACACTGCGAGTCGGTGTTCCTGCATGC
CommentsAntisense riboprobes were prepared from chicken RARβ2 (nt 1–202) [Noji et al 1991]. Sequence here was taken from this source.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
stage 6
stage 6
Lateral Plate Mesoderm
Comparison of several genes.
7-10
stage 7
stage 7
stage 8
stage 8
stage 9
stage 10
Heart Tube
Lateral Plate Mesoderm
Neural Crest
Paraxial Mesoderm
Sinus Venosus
Splanchnic Mesoderm
Surface Ectoderm
Cardiogenic region
Comparison of several genes.
Precardiac mesoderm and endoderm

Entry 2

GEISHA IdRar.Rodriguez-Guzman.2007Data SourcePublication
Complete cDNA Template Probeshow
CGGCGGCGGGAGGGGCGGCCGCGGAGGATGTCAGACTGGCCTAGGACTTTGAAAACTACCCCATTGTCAAGCTCCCTCT
GAGCTGCTTCCAGCCCTCAGGAGCGAAGGTAGAGTTAAGGCGACTCCATCAGTATGCATCTGTAGAGAGCAACTATCCT
CACAGAAAAACATTTGAATAAACAACTGAATGGTGGTCTGAGACACGGACTAAGACAACTTTCTGTCCACAGTCTTCAG
AGCAGGAATGTCTGGACAAGAGAACAGTAGGAAGCAGCAATGAAATATAGGACGGGACTGATCTAGTGAATTACCTCTT
CACCATCACACAGTCCAGCTCAAGCCACACCTGCAGGCTTGACAGCCCTCTCCATTTACAAGTTCAAGTATCTGCTTGC
TGGCCTGGAGTGATGCAACATATTATTTATACACTGTGAGCTATTAACATGACAACCAGCAGCCGCACATGTCCAGTGC
CGGCAGTGAATGGACATATGACTCACTACCCAGCAGCTCCATACCCGTTACTTTTTCCTCCAGTCATCGGTGGGCTGTC
GCTGCCTTCCCTTCATGGACTCCAGAGTCACCCACCAACGAGCGGATGCAGCACCCCATCACCTGCAACAGTTGAAACT
CAGAGCACCAGTTCTGAGGAACTTGTTCCAAGCCCTCCTTCACCACTTCCACCCCCGCGTGTTTACAAGCCCTGTTTTG
TCTGTCAAGACAAATCATCTGGATATCACTATGGTGTCAGTGCTTGTGAGGGATGTAAGGGCTTTTTCCGCAGGAGTAT
CCAGAAGAACATGGTTTACACATGTCATAGAGATAAGAACTGTGTTATCAATAAAGTTACCAGAAATCGCTGCCAGTAC
TGCAGACTACAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGAAATGATAGGAACAAAAAGAAGAAGGAAC
CTACAAAGCAGGAGTCCACAGAAAACTATGAAATGACAGCAGAGCTGGATGATCTCACTGAGAAGATCCGAAAAGCTCA
CCAGGAAACCTTCCCCTCGCTCTGCCAGCTGGGAAAGTACACTACAAACTCGAGTGCAGACCATCGGGTTCGACTGGAC
CTTGGGCTCTGGGACAAATTCAGTGAACTTGCAACAAAGTGCATTATTAAAATAGTGGAATTTGCAAAACGATTGCCAG
GCTTTACAAGCTTGACCATTGCAGACCAGATAACTCTACTTAAAGCAGCCTGCCTGGACATACTGATCCTCAGAATTTG
CACAAGATACACACCAGAACAAGACACCATGACATTTTCAGATGGCCTTACCCTGAACCGAACTCAGATGCACAATGCT
GGATTTGGCCCCCTGACCGACCTCGTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACCG
GTCTCCTTAGTGCCATCTGCTTGATCTGTGGAGATCGCCAGGACCTTGAAGAACCAATGAAAGTGGATAAGCTTCAGGA
ACCGTTGCTTGAAGCGCTGAAAATCTATATCCGAAAGAGACGACCCAACAAGCCTCACATGTTTCCAAAGATCTTAATG
AAAATCACAGATCTTCGTAGCATCAGTGCAAAAGGTGCAGAACGTGTCATTACGTTGAAAATGGAAATTCCTGGATCCA
TGCCACCTCTTATTCAAGAAATGTTGGAGAACTCTGAAGGACACGAACCACTGACACCAACCTCAAATGGAAATACTGC
AGAACACAGTCCGAGTATCTCACCGAGCTCAGTGGATAACAGCAGTGTCAGTCAATCCCCTATGGTGCAATAAGACATT
TTCCAGCTACTTCAGACATTCCTAACACCTTATGTACAGGGATGAAAAGCAAGAAAAACATTTTTACTGCTGCTTACTT
TCTGGACTTAATATATATCTATATATGTATATATATATATATAGATAAAAACTCAACAAGGACCAAGAAATTTTCGTAT
GTATCAATATATACTCCTTGCTGTTTAA
CitationRodriguez-Guzman m, Montero JA, Santesterban E, Gañan Y, Macias D, Hurle JM. Tendon-muscle crosstalk controls muscle bellies morphogenesis, which is mediated by cell death and retinoic acid signaling. Dev Biol. 2007 Feb 1;302(1):267-80.
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsAuthors state the probe was obtained from U. Albrecht. As information provided is insufficient to verify exact sequence used to synthesize the probe, the sequence below was obtained from NCBI (Acc # NM_205326.1)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-32
stage 32
Leg Mesenchyme
 

Entry 3

GEISHA IdRARBETA.Bayha.2009Data SourcePublication
Complete cDNA Template Probeshow
CGGCGGCGGGAGGGGCGGCCGCGGAGGATGTCAGACTGGCCTAGGACTTTGAAAACTACCCCATTGTCAAGCTCCCTCT
GAGCTGCTTCCAGCCCTCAGGAGCGAAGGTAGAGTTAAGGCGACTCCATCAGTATGCATCTGTAGAGAGCAACTATCCT
CACAGAAAAACATTTGAATAAACAACTGAATGGTGGTCTGAGACACGGACTAAGACAACTTTCTGTCCACAGTCTTCAG
AGCAGGAATGTCTGGACAAGAGAACAGTAGGAAGCAGCAATGAAATATAGGACGGGACTGATCTAGTGAATTACCTCTT
CACCATCACACAGTCCAGCTCAAGCCACACCTGCAGGCTTGACAGCCCTCTCCATTTACAAGTTCAAGTATCTGCTTGC
TGGCCTGGAGTGATGCAACATATTATTTATACACTGTGAGCTATTAACATGACAACCAGCAGCCGCACATGTCCAGTGC
CGGCAGTGAATGGACATATGACTCACTACCCAGCAGCTCCATACCCGTTACTTTTTCCTCCAGTCATCGGTGGGCTGTC
GCTGCCTTCCCTTCATGGACTCCAGAGTCACCCACCAACGAGCGGATGCAGCACCCCATCACCTGCAACAGTTGAAACT
CAGAGCACCAGTTCTGAGGAACTTGTTCCAAGCCCTCCTTCACCACTTCCACCCCCGCGTGTTTACAAGCCCTGTTTTG
TCTGTCAAGACAAATCATCTGGATATCACTATGGTGTCAGTGCTTGTGAGGGATGTAAGGGCTTTTTCCGCAGGAGTAT
CCAGAAGAACATGGTTTACACATGTCATAGAGATAAGAACTGTGTTATCAATAAAGTTACCAGAAATCGCTGCCAGTAC
TGCAGACTACAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGAAATGATAGGAACAAAAAGAAGAAGGAAC
CTACAAAGCAGGAGTCCACAGAAAACTATGAAATGACAGCAGAGCTGGATGATCTCACTGAGAAGATCCGAAAAGCTCA
CCAGGAAACCTTCCCCTCGCTCTGCCAGCTGGGAAAGTACACTACAAACTCGAGTGCAGACCATCGGGTTCGACTGGAC
CTTGGGCTCTGGGACAAATTCAGTGAACTTGCAACAAAGTGCATTATTAAAATAGTGGAATTTGCAAAACGATTGCCAG
GCTTTACAAGCTTGACCATTGCAGACCAGATAACTCTACTTAAAGCAGCCTGCCTGGACATACTGATCCTCAGAATTTG
CACAAGATACACACCAGAACAAGACACCATGACATTTTCAGATGGCCTTACCCTGAACCGAACTCAGATGCACAATGCT
GGATTTGGCCCCCTGACCGACCTCGTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACCG
GTCTCCTTAGTGCCATCTGCTTGATCTGTGGAGATCGCCAGGACCTTGAAGAACCAATGAAAGTGGATAAGCTTCAGGA
ACCGTTGCTTGAAGCGCTGAAAATCTATATCCGAAAGAGACGACCCAACAAGCCTCACATGTTTCCAAAGATCTTAATG
AAAATCACAGATCTTCGTAGCATCAGTGCAAAAGGTGCAGAACGTGTCATTACGTTGAAAATGGAAATTCCTGGATCCA
TGCCACCTCTTATTCAAGAAATGTTGGAGAACTCTGAAGGACACGAACCACTGACACCAACCTCAAATGGAAATACTGC
AGAACACAGTCCGAGTATCTCACCGAGCTCAGTGGATAACAGCAGTGTCAGTCAATCCCCTATGGTGCAATAAGACATT
TTCCAGCTACTTCAGACATTCCTAACACCTTATGTACAGGGATGAAAAGCAAGAAAAACATTTTTACTGCTGCTTACTT
TCTGGACTTAATATATATCTATATATGTATATATATATATATAGATAAAAACTCAACAAGGACCAAGAAATTTTCGTAT
GTATCAATATATACTCCTTGCTGTTTAA
CitationBayha E, Jørgensen MC, Serup P, Grapin-Botton A. Retinoic acid signaling organizes endodermal organ specification along the entire antero-posterior axis. PLoS One. 2009 Jun 10;4(6):e5845.
Copyrighthttp://creativecommons.org/licenses/by/2.5/
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205326).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
stage 10
Anterior Intestinal Portal
Endoderm
Gut
Neural Plate/Tube
 

Entry 4

GEISHA IdRARB.Mercader.2000Data SourcePublication
Complete cDNA Template Probeshow
CGGCGGCGGGAGGGGCGGCCGCGGAGGATGTCAGACTGGCCTAGGACTTTGAAAACTACCCCATTGTCAAGCTCCCTCT
GAGCTGCTTCCAGCCCTCAGGAGCGAAGGTAGAGTTAAGGCGACTCCATCAGTATGCATCTGTAGAGAGCAACTATCCT
CACAGAAAAACATTTGAATAAACAACTGAATGGTGGTCTGAGACACGGACTAAGACAACTTTCTGTCCACAGTCTTCAG
AGCAGGAATGTCTGGACAAGAGAACAGTAGGAAGCAGCAATGAAATATAGGACGGGACTGATCTAGTGAATTACCTCTT
CACCATCACACAGTCCAGCTCAAGCCACACCTGCAGGCTTGACAGCCCTCTCCATTTACAAGTTCAAGTATCTGCTTGC
TGGCCTGGAGTGATGCAACATATTATTTATACACTGTGAGCTATTAACATGACAACCAGCAGCCGCACATGTCCAGTGC
CGGCAGTGAATGGACATATGACTCACTACCCAGCAGCTCCATACCCGTTACTTTTTCCTCCAGTCATCGGTGGGCTGTC
GCTGCCTTCCCTTCATGGACTCCAGAGTCACCCACCAACGAGCGGATGCAGCACCCCATCACCTGCAACAGTTGAAACT
CAGAGCACCAGTTCTGAGGAACTTGTTCCAAGCCCTCCTTCACCACTTCCACCCCCGCGTGTTTACAAGCCCTGTTTTG
TCTGTCAAGACAAATCATCTGGATATCACTATGGTGTCAGTGCTTGTGAGGGATGTAAGGGCTTTTTCCGCAGGAGTAT
CCAGAAGAACATGGTTTACACATGTCATAGAGATAAGAACTGTGTTATCAATAAAGTTACCAGAAATCGCTGCCAGTAC
TGCAGACTACAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGAAATGATAGGAACAAAAAGAAGAAGGAAC
CTACAAAGCAGGAGTCCACAGAAAACTATGAAATGACAGCAGAGCTGGATGATCTCACTGAGAAGATCCGAAAAGCTCA
CCAGGAAACCTTCCCCTCGCTCTGCCAGCTGGGAAAGTACACTACAAACTCGAGTGCAGACCATCGGGTTCGACTGGAC
CTTGGGCTCTGGGACAAATTCAGTGAACTTGCAACAAAGTGCATTATTAAAATAGTGGAATTTGCAAAACGATTGCCAG
GCTTTACAAGCTTGACCATTGCAGACCAGATAACTCTACTTAAAGCAGCCTGCCTGGACATACTGATCCTCAGAATTTG
CACAAGATACACACCAGAACAAGACACCATGACATTTTCAGATGGCCTTACCCTGAACCGAACTCAGATGCACAATGCT
GGATTTGGCCCCCTGACCGACCTCGTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACCG
GTCTCCTTAGTGCCATCTGCTTGATCTGTGGAGATCGCCAGGACCTTGAAGAACCAATGAAAGTGGATAAGCTTCAGGA
ACCGTTGCTTGAAGCGCTGAAAATCTATATCCGAAAGAGACGACCCAACAAGCCTCACATGTTTCCAAAGATCTTAATG
AAAATCACAGATC
CitationMercader N, Leonardo E, Piedra ME, Martínez-A C, Ros MA, Torres M. Opposing RA and FGF signals control proximodistal vertebrate limb development through regulation of Meis genes. Development. 2000 Sep;127(18):3961-70.
Copyright© The Company of Biologists Limited 2000
CommentsThe sequence below was obtained from NCBI (acc #: NM_205326.1 - Showing 1.59kb region up to base 1593) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
Limb Buds
left side = control side
right side = RAA +FGF8
19-22
stage 21
stage 22
stage 22
Limb Buds
left side = control side
right side = -RAA
right side = FGF1 bead
right side = FGF8 bead
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.51498

Mouse

EmageMGI:97857
EurexpressMGI:97857
MGI GXDMGI:97857

Frog

Xenbase481008, 484126

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-531
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona